Category Archives: Διαγωνίσματα Προσομοίωσης

ΒΙΟΛΟΓΙΑ ΟΜΑΔΑΣ ΘΕΤΙΚΟΥ ΠΡΟΣΑΝΑΤΟΛΙΣΜΟΥ ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΕΙΩΣΗΣ 2018

 

ΖΗΤΗΜΑ 1Ο

A.

1) Η φαινοτυπική αναλογία της διασταύρωσης ΑΑΒΒΓΓ x ααββγγ στο πρότυπο διασταυρώσεων κατά Μέντελ είναι:

α) (3+1)3

β) (9+1)2

γ) (3+3)2

δ) Τίποτα από τα παραπάνω

2) Ενα υβρίδωμα:

α) είναι τετραπλοείδες για το γονιδίωμα του ποντικου

β) είναι διπλοειδές για το γονιδίωμα του ποντικου

γ) είναι ένα ετεροκαρυο που φέρει τόσο το διπλοειδές γονιδίωμα του ποντικου όσο και το διπλειδες γονιδιωμα του ανθρώπου

δ) φέρει το γονιδίωμα του ποντικου και το γονιδίωμα του μυελώματος και τα ανθρωπινα γονίδια για την παραγωγη των μονοκλωνικών αντισωμάτων.

3) Τα νουκλεϊκά οξέα είναι αποκλειστικά δομημένα από:

 α) μέταλλα

β) αμέταλλα

γ) μέταλλα και αμέταλλα

δ) είναι μονομερή των κυττάρων

4) Οι δεσμοί υδρογόνου (δ.Η) και οι φωσφοδιεστερικοί δεσμοί (Ρ-δ) απαντώνται στα δίκλωνα μόρια νουκλεϊκών οξέων.

α) Οι δ.Η είναι ασθενείς και δημιουργούνται αυθορμήτως μεταξύ των δύο πολυνουκλεοτιδικών αλυσίδων.

β) Οι Ρ-δ είναι ομοιοπολικοί ισχυροί δεσμοί που δημιουργούνται in vivo κατά τη φάση S και συγκρατούν τα νουκλεοτίδια  σε ένα πολυνουκλεοτιδικό κλώνο.

γ) Οι δ.Η σταθεροποιούν τη δομή της διπλής έλικας. Οι Ρ-δ απαιτούν κατανάλωση ενέργειας για να δημιουργηθούν.

δ) Όλα τα παραπάνω είναι ορθά.

ε) Τίποτα από τα παραπάνω δεν ισχύει.

5) Στα ευκαρυωτικά κύτταρα και στα προκαρυωτικά κύτταρα ισχύει:

γονίδια / γονιδίωμα = ε για ευκαρυωτικά, γονίδια / γονιδίωμα  = π για προκαρυωτικά

Ισχύει γενικά:

α) ε > π

β) π > ε

γ) π = ε

δ) Τίποτα από τα παραπάνω δεν είναι σωστό.

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις.

 1) Το νουκλεόσωμα αποτελείται από 146 ζεύγη νουκλεοτιδίων και 9 πρωτεΐνες.

2) Τα βακτηριακά κύτταρα μίας υγρής καλλιέργειας εκφράζουν τα ίδια γονίδια τόσο στην εκθετική όσο και στη στατική φάση μίας κλειστής καλλιέργειας, δεν εκφράζουν όμως γονίδια κατά τη φάση θανάτου.

3) Είναι εφικτή η δημιουργία cDNA βιβλιοθήκης ενός ρετροϊού, ενός αδενοϊού και του Τ2.

4) Μία μετάλλαξη που καταργεί τη ΘΕΑ του χρωμοσωμικού DNA των βακτηρίων είναι θανατηφόρος. Ομοίως, είναι θνησιγόνα μετάλλαξη και η κατάργηση από μετάλλαξη μίας ΘΕΑ από χρωμοσωμικό DNA ενός ανώτερου φυτού.

5) Σε ενα άτομο ομόζυγο για τα γονίδια βς, έγινε cDNA βιβλιοθήκη των ερυθροκυτταρων του, πριν και μετά την πλήρη θεραπεία του. Μεταξύ ενός ανιχνευτη αποτελούμενο από 25 νουκλεοτίδια και ενός ανιχνευτη αποτελούμενο από 5 νουκλεοτίδια, ποιον θα επέλεγαν οι επιστήμονες για να διακρίνουν τις δυο βιβλιοθήκες του ατόμου αυτού;

6) Αιμοσφαιρινη Α δεν παράγεται στα εμβρυακά ερυθροκύτταρα.

7) Οι δισουλφιδικοί δεσμοί αναπτύσσονται στις πρωτεινες μεταξύ των κυστείνων.

8) Οι επιλεκτικές διασταυρώσεις είναι βιοτεχνολογική μέθοδος

9) Εαν γνωρίζεται ότι το καρβοξυτελικό άκρο της λειτουργικής πρωτεινης είναι στο μικρο πεπτίδιο στο σχήμα που σας δίνεται  πάνω τότε σχεδιάστε πάνω στο μόριο της προϊνσουλίνης τους προσανατολισμούς του ενδιάμεσου πεπτιδιου που αφαιρείται. (2)

img8_2.jpg

(μονάδες 10)

ΖΗΤΗΜΑ 2Ο

 1) Δίνεται το παρακάτω πειραματικό σχήμα των Lederberg and Tatum 1946: 

2018 Προσομοίωση θετικής-02

ΥΠΟΜΝΗΜΑ

1) Bio = Βιοτίνη

2) Phe = Φαινυλαλανίνη

3) Cys = Kυστεΐνη

4) Thr = Θρεονίνη

5) Leu = Λευκίνη

6) Thi = Θειαμίνη

Τα τρυβλία 1 και 2 καθώς και 3 δεν περιέχουν τα συστατικά 1 έως 6 αλλά τα απαραίτητα συστατικά για να συντεθούν μέσω του μεταβολισμού των κυττάρων

Στο επόμενο σχήμα δίνεται η πειραματική διάταξη του Β. Davis (1950).

2018 Προσομοίωση θετικής-03

Ποιο είναι το συμπέρασμα που προκύπτει από τα δύο παραπάνω πειράματα;

(15 μονάδες)

2) Δίνονται τα παρακάτω διαγράμματα μεταξύ των ατόμων δύο πληθυσμών που ακολουθούν το πρότυπο διασταυρώσεων κατά Mendel.

2018 Προσομοίωση θετικής-04

Εξηγήστε ποιος χαρακτήρας ελέγχεται μονογονιδιακά και ποιος πολυγονιδιακά (5).

3) Δίνεται το παρακάτω διάγραμμα που εκφράζει την πιθανότητα εμφάνισης μίας μετάλλαξης σε συνάρτηση με το χρόνο έκθεσης των σωματικών κυττάρων σε σταθερή δόση ακτινοβολίας ικανής για μεταλλαξιγένεση (5).

2018 Προσομοίωση θετικής-05

Εξηγήστε για ποιο λόγο τα κύτταρα εμφανίζουν μεγαλύτερη ακτινοευαισθησία στη μεσοφάση.

ΖΗΤΗΜΑ 3Ο                                                                                          ΜΟΝΑΔΕΣ 25

 1) Σας δίνεται το παρακάτω διάγραμμα μεταβολής της θερμοκρασίας σε συνάρτηση με το χρόνο. Σε ποια διαδικασία λαμβάνουν χώρα αυτές οι μεταβολές κυκλικά(2); Γιατί απαιτούνται αυτές οι θερμοκρασίες, τι συμβαίνει κάθε φορά(6); Γιατί οι φάσεις 2 έως 5 επαναλαμβάνονται 30 φορές, ποιο θα είναι το τελικό προϊόν αυτής της επαναληψιμότητας(6);

20170924_095456

2) Ένα φυσιολογικό άτομο προσέρχεται στο νοσοκομείο και εξετάζεται ο καρυότυπός του λαμβάνοντας από το άτομο αυτό αίμα. Μετά το τέλος της διαδικασίας δημιουργίας του καρυότυπου, στο άτομο αυτό εμφανίστηκαν δύο διαφορετικού φύλου, φυσιολογικοί ανθρώπινοι καρυότυποι.

α) Εξηγήστε πώς είναι δυνατόν κάτι τέτοιο!(4)

β) Ποια θα αναμένεται να είναι η ερώτηση που έκαναν οι γιατροί στον άνθρωπο αυτό, μετά την παρατήρηση του καρυότυπού του (3).

γ) Το άτομο αυτό έχει ομάδα αίματος Ο σύμφωνα με το σύστημα ΑΒΟ. Πόσες πρωτεΐνες ευθύνονται για την εμφάνιση αυτού του φαινοτύπου(4);

ΖΗΤΗΜΑ 4Ο

1) Στον πασίγνωστο Αρχαίο Ελληνικό μύθο του Οιδίποδα, ο ήρωας γίνεται τυχαία πατροκτόνος και στη συνέχεια εν αγνοία του παντρεύεται τη μητέρα του Ιοκάστη. Ο Οιδίποδας και η Ιοκάστη απέκτησαν τέσσερα παιδιά, τον Πολυνίκη, τον Ετεοκλή, την Αντιγόνη και την Ισμήνη.

Όταν ο Οιδίποδας έμαθε ποιον σκότωσε και ποια παντρεύτηκε, τυφλώθηκε και στη συνέχεια αυτοεξορίστηκε.

Παρακάτω δίνεται το γενεαλογικό δέντρο της οικογένειας του Οιδίποδα, όπως περιγράφεται στο μύθο.

2018 Προσομοίωση θετικής-06

Σύμφωνα με τον παραπάνω μύθο και με βάση τις γνώσεις σας στη Βιολογία, απαντήστε στις ερωτήσεις:

α) Ποιο είναι το μέγιστο και ποιο το ελάχιστο ποσοστό χρωμοσωμάτων μητρικής προέλευσης που φέρει η Αντιγόνη και η Ισμήνη;

β) Απαντήστε στο ίδιο ερώτημα για τα αρσενικά παιδιά του ζεύγους Οιδίποδα – Ιοκάστης.

γ) Μια σπάνια νόσος που οδηγεί σε τύφλωση εμφανίζεται σε άνδρες και γυναίκες αλλά οι άνδρες όταν εμφανίζουν αυτή τη νόσο πολύ συχνά εμφανίζουν και τρίχες στο εσωτερικό των αυτιών τους. Οι γυναίκες φυσιολογικά δεν εμφανίζουν ποτέ τρίχες στα αυτιά, είτε νοσούν από την ασθένεια που οδηγεί σε τύφλωση, είτε όχι. Όμως υπάρχουν άνδρες με τρίχες στο εσωτερικό των αυτιών που όμως δε νοσούν από αυτή τη μορφή τύφλωσης.

Τόσο ο Λάιος, όσο και ο Οιδίποδας καθώς και οι δύο γιοί του Οιδίποδα εμφανίζουν τρίχες στο εσωτερικό των αυτιών τους. Ωστόσο ο βασιλιάς Λάιος δεν εμφάνισε τη νόσο που θα τον τύφλωνε, παρόλο που είχε ξεπεράσει κατά πολύ την ηλικία εμφάνισής της όταν θανατώθηκε από το γιο του Οιδίποδα.

Με ποια πιθανότητα κάθε γιος του Οιδίποδα θα εμφανίσει τη νόσο της τύφλωσης αυτής;

Υπάρχει περίπτωση η Αντιγόνη και η Ισμήνη να νοσήσουν από αυτή τη μορφή τύφλωσης; Εάν ναι, τότε οι κόρες του Οιδίποδα θα εμφανίσουν και τρίχες στο εσωτερικό των αυτιών τους;

δ) Ο πρωτότοκος γιος του Οιδίποδα, ο Πολυνείκης, εάν παντρευόταν την αδελφή του Ισμήνη και έκαναν δύο παιδιά, ένα αγόρι και ένα κορίτσι, με ποια πιθανότητα κάθε παιδί θα εμφάνιζε τρίχες στα αυτιά και αυτή τη μορφή τύφλωσης;

Θεωρούμε γνωστό ότι: Ο Πολυνιίκης δεν τυφλώθηκε και είχε τρίχες στα αυτιά. Η Ισμήνη δεν τυφλώθηκε και ως γυναίκα δεν είχε τρίχες στα αυτιά. (5 * 4)

2) Δίνονται τα παρακάτω δύο πλασμίδια:

2018 Προσομοίωση θετικής-07

Το πλασμίδιο Α πέπτεται από την περιοριστική ενδονουκλεάση EcoRI.

Το πλασμίδιο Β πέπτεται από μια διαφορετική ενδονουκλεάση που αναγνωρίζει τη δίκλωνη αλληλουχία   GAATTC

CTTAAG

και σπάζει τους φωσφοδιεστερικούς δεσμούς μεταξύ του CT αφήνοντας κολλώδη άκρα.

Τα πλασμίδια Α και Β μπορούν να ανασυνδυαστούν μετά την πέψη τους από τις περιοριστικές ενδονουκλεάσες με τη δράση της DNA δεσμάσης (5);

 

Advertisements

ΔΙΑΓΩΝΙΣΜΑ ΠΡΟΣΟΜΟΙΩΣΗΣ 2018 (Β)

ΖΗΤΗΜΑ 1Ο

 Α. Επιλέξτε τη σωστή επιλογή που συμπληρώνει σωστά την πρόταση.

(μονάδες 20)

1) Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά τις ομάδες αίματος στο σύστημα ΑΒΟ του ανθρώπου:

2017 Διαγώνισμα προσομοίωσης Β-01

Τα άτομα της ΙΙΙ γενεάς έχουν φαινοτύπους:

α) Ο, Α, Β, Ο, Ο με πιθανότητα  (1/4)3 x(1/2) 2

β) Ο, Β, Ο, Α, Α με πιθανότητα  4 x(1/4)

γ) Ο, Α, Β, Ο, Α με πιθανότητα   1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4

δ) Ο, Ο, Ο, Ο, Ο με πιθανότητα  1 –  1023/1024

ε) Τίποτα από τα παραπάνω.

 

2) Δίνεται η παρακάτω υποθετική αλληλουχία του ενός κλώνου (κωδική

 

) γονιδίου που κωδικοποιεί για tRNA.

 

ΥΠΟΚΙΝΗΤΗΣ                   ΕΣΩΝΙΟ                     ΕΣΩΝΙΟ                        ΑΛΜ

ATCGCCTTAACCTACTACGCCTATACTATTCTATCCCCGCTATCTCATTCCTTT

—————-                    —————-                        ————                 ————-

Ποια είναι αλληλουχία του ώριμου μεταγραφήματος;

α) Ομοίως με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

β) Συμπληρωματική με την παραπάνω αποτελούμενη από ριβονουκλεοτίδια.

γ) Όμοια με την παραπάνω χωρίς τον υποκινητή και τα εσώνια αποτελούμενη από ριβονουκλεοτίδια.

δ) Συμπληρωματική με την παραπάνω χωρίς τον υποκινητή, τα εσώνια και τις ΑΛΜ αποτελούμενη από ριβονουκλεοτίδια.

ε) Τίποτα από τα παραπάνω.

3) Ένα άτομο προσήλθε στο νοσοκομείο και μετά από βιοχημικές εξετάσεις διαπιστώθηκε ότι έχει αυξημένα επίπεδα HbA2 και ήταν μολυσμένο από το πλασμώδιο. Το άτομο αυτό:

α) Νοσεί από δρεπανοκυτταρική αναιμία.

β) Νοσεί από β-θαλασσαιμία.

γ) Νοσεί από λοιμώδες νόσημα (ελονοσία).

δ) Είναι φορέας μίας γενετικής νόσου και δεν κινδυνεύει να πεθάνει από ελονοσία.

ε) Είναι φορέας δύο ασθενειών, της δρεπανοκυτταρικής αναιμίας (γενετική νόσος) και της ελονοσίας (λοιμώδης).

4) Ο καρκίνος είναι ένα γενετικό νόσημα που οφείλεται κατά κανόνα σε:

α) Έλλειψη πρωτοογκογονιδίων και υπερλειτουργία ογκοκατασταλτικών.

β) Έλλειψη ογκοκατασταλτικών και υπερλειτουργία πρωτοογκογονιδίων.

γ) Έλλειψη επιδιορθωτικών ενζύμων και υπερέκφραση ογκοκατασταλτικών γονιδίων.

δ) Λάθη που γίνονται κατά τη μείωση και τη μίτωση και οδηγεί σε ανευπλοειδία.

ε) Τίποτα από τα παραπάνω.

5) Στο βακτήριο E.coli η φυσιολογική έκφραση του ρυθμιστικού γονιδίου του οπερονίου της λακτόζης (υποθετικό) έχει ρυθμό 20 μόρια καταστολέα/24h και ρυθμό αποικοδόμησης καταστολέων 10 μόρια καταστολέα/24h όταν το βακτήριο αναπτύσσεται σε περιβάλλον με 100% γλυκόζη. Ένα βακτήριο που αναπτύσσεται σε περιβάλλον γλυκόζης και λακτόζης μετράται η παραγωγή των mRNA που κωδικοποιούνται από το οπερόνιο της λακτόζης.

2017 Διαγώνισμα προσομοίωσης Β-02

Στις χρονικές στιγμές t1, t2, t3 αντιστοίχως έχουμε:

α) 10 μόρια,     100 μόρια,        0 μόρια

β) 0 μόρια,       100 μόρια,        100 μόρια

γ) 10 μόρια,     100 μόρια,        100 μόρια

δ) 100 μόρια,   1000 μόρια,      0 μόρια

ε) Τίποτα από τα παραπάνω

Β. Χαρακτηρίστε ως Σ (Σωστή) ή Λ (Λανθασμένη) την καθεμία από τις παρακάτω προτάσεις:

α) Ένα πείραμα in vivo είναι το πείραμα δημιουργίας αμιγών στελεχών του Mendel.

β) Η Τρισωμία 21 έχει περισσότερες πιθανότητες να εμφανιστεί κατά τη μείωση σε σχέση με οποιαδήποτε άλλη τρισωμία του ανθρώπου.

γ) Για τα γονίδια α των αιμοσφαιρίνων ισχύουν οι νόμοι του Mendel.

δ) Ένα θηλυκό άτομο έχει όλα του τα γονίδια σε δύο αντίγραφα, ένα αρσενικό άτομο όχι.

ε) Το ρετινοβλάστωμα είναι μορφή καρκίνου που ελέγχεται μονογονιδιακά.

στ) Υπάρχει γονίδιό μας που γι’ αυτό υπάρχουν εκατοντάδες αντίγραφά του σε ένα μας κύτταρο.

ζ) Το ίδιο προϊόν ζύμωσης μπορεί να παράγεται από τον ίδιο μικροοργανισμό σε μεγάλες ποσότητες, τόσο στην εκθετική όσο και στη στατική.

η) Οι στόχοι της Ιατρικής είναι με τη σειρά: Η πρόληψη, η διάγνωση και η θεραπεία.

θ) Για τη δημιουργία των Β+ φυτών δημιουργήθηκε cDNA βιβλιοθήκη του B. thurigiensis.

ι) Τα προϊόντα της ζύμωσης μπορεί να είναι ζωντανά ή νεκρά ή προϊόντα ζωντανών κυττάρων.

 

ΖΗΤΗΜΑ 2Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α. Δίνεται ο παρακάτω πίνακας. Να πραγματοποιηθούν όλες οι πιθανές αντιστοιχίσεις.

                                                            (μονάδες 5)

ΣΥΜΠΛΗΡΩΜΑΤΙΚΟΤΗΤΑ
1.     ΠΡΩΤΑΡΧΙΚΟ ΤΜΗΜΑ RNA Α. in vivo
2.     ΣΥΝΔΕΣΗ ΜΕΤΑΓΡΑΦΙΚΩΝ ΠΑΡΑΓ.
3.     ΔΗΜΙΟΥΡΓΙΑ 3΄       5΄ Ρ-ΔΕΣΜΩΝ B. in vitro
4.     ΣΥΝΔΕΣΗ ΚΟΛΛΩΔΩΝ ΑΚΡΩΝ
5.     ΙΧΝΗΘΕΤΗΜΕΝΟΣ ΑΝΙΧΝΕΥΤΗΣ Γ. ΤΙΠΟΤΑ ΑΠΟ ΤΑ ΠΑΡΑΠΑΝΩ

Β. 1) Ποιο θα είναι το αποτέλεσμα στην πρωτεΐνη που παράγεται σε προκαρυωτικό κύτταρο, αν στο γονίδιο που την κωδικοποιεί γίνει αντικατάσταση μίας βάσης;

(μονάδες 8)

2) Με ποιον από τους παρακάτω τρόπους θα μπορούσε να προκύψει ένα μηρυκαστικό ζώο το οποίο να παράγει τον απηκτικό παράγοντα ΙΧ στο γάλα του: α) Με τη μέθοδο των επιλεκτικών διασταυρώσεων.

β) Με μεθόδους Γενετικής Μηχανικής.                                                    (μονάδες 2)

Αιτιολογήστε την απάντησή σας.                                                            (μονάδες 5)

3) Να αναφέρετε τα πλεονεκτήματα παραγωγής ανθρώπινης αυξητικής ορμόνης με μεθόδους Γενετικής Μηχανικής σε σχέση με την εξαγωγή της από πτώματα.

(μονάδες 5)

ΖΗΤΗΜΑ 3Ο

Α. Η Ράνια και η Αρεθα είναι δύο φίλες που ταξίδεψαν στο Περού πριν από μερικά χρόνια. Κατά το ταξίδι τους στα υψίπεδα των Άνδεων, εμφάνισαν συμπτώματα αναιμίας και μεταφέρθηκαν στο τοπικό νοσοκομείο, όπου και διαγνώστηκαν φαινοτυπικα ως ετεροζυγες για κάποιο παθολογικό αλληλόμορφο του γενετικού τόπου, όπου εδράζεται το γονίδιο της β σφαιρινης στο 11 χρωμόσωμα μας. Τα γονίδιά της α σφαιρινης εδράζονται στο 16ο χρωμόσωμα μας.

Μετά από βιοχημικές και μοριακές εξετάσεις στην Ελλάδα αποδείχθηκε ότι η Ράνια είναι φορέας της δρεπανοκυτταρική αναιμίας και η Αρεθα της μεσογειακής αναιμίας.

Παρακάτω φαίνεται το γενεαλογικό δένδρο των οικογενειών που δημιούργησαν οι δυο φίλες.

 2018 διόρθωση-01

Το άτομο ΙΙ3 νοσεί από δρεπανοκυτταρική αναιμία και το άτομο ΙΙ6 νοσεί από μεσογειακή αναιμία. Είναι γνωστό ότι τα άτομα ΙΙ8, ΙΙΙ7, ΙV6 είναι ομόζυγα φυσιολογικά για την μεσογειακή αναιμία και το άτομο ΙΙ1 είναι επίσης ομόζυγο φυσιολογικό για το γονίδιο β, ενώ ένα μόνο από τα άτομα ΙΙΙ2, ΙV2, V2 είναι ετεροζυγο για το γονίδιο βς.

Το άτομο VII1 γεννήθηκε με μίκροδρεπανοκυττταρική αναιμία.

α. Εάν υποθέσουμε ότι τα σχολικά εγχειρίδια στο Περού, κάνουν αναφορά στην δρεπανοκυτταρική αναιμία και την μεσογειακή αναιμία, με ποιο τρόπο κληρονόμησης νομίζετε ότι θα αναφέρουν ότι κληρονομούνται οι ασθένειες αυτές; (μονάδες 2)

β. Ποιά ήταν οι πιθανότητα, οι δυο φίλες να αποκτήσουν τον απόγονο VII1, που νοσεί από μίκροδρεπανοκυττταρική αναιμία, όπως προκύπτει από το γενεαλογικό δένδρο ; (5)

γ. Το ζευγάρι VI1, VI2, πρόκειται να αποκτήσει και δεύτερο παιδί. Το ζευγάρι ζήτησε γενετική καθοδήγηση για το ποιό είναι το ενδεχόμενο να αποκτήσει υγιές κορίτσι,  φορέα της δρεπανοκυτταρική αναιμίας ή υγιές αγόρι, φορέα της μεσογειακής αναιμίας ή υγιές κορίτσι ομόζυγο για το φυσιολογικό γονίδιο β1 ή υγιές αγόρι φορέα της δρεπανοκυττταρικής αναιμίας.

Τι τους απάντησε ο γενετιστής πριν και μετά τις μοριακές εξετάσεις για το γονίδιο β στο έμβρυο. Οι γονείς δεν θέλησαν ωστόσο να μάθουν το φύλο του δεύτερου παιδιού τους πριν την γέννηση του.(6)

Η μοριακή εξέταση έγινε με μια περιοριστική ενδονουκλεαση που πέπτει το αλληλόμορφο βς και το β όχι. Επίσης αποδείχθηκε ότι το παθολογικό αλληλόμορφο β1 για την μεσογειακή αναιμία έχει πάθει έλλειψη 25 ζ.β εντός της 5´ αμεταφραστής περιοχής του.

δ. Για ποιο λόγο η αναιμία, που προκαλείται από το αλληλόμορφο β1, αλλά και διάφορα άλλα παθολογικά αλληλόμορφα του γενετικού τόπου της β σφαιρίνης, που οδηγούν σε ελάττωση της φυσιολογικής ποσότητας της HbA ονομάζεται μεσογειακή αναιμία ; (3)

ε. Είναι γνωστό ότι το γονίδιο για την α σφαιρίνη εδράζεται στο 16 χρωμόσωμα μας, και αυτός ο γενετικός τόπος είναι διπλός, διαδοχικά ο ένας μετά τον άλλο. Ο γενετικός τόπος δε, 16p13.2 (πάνω) εκφράζεται με μικρότερο ρυθμό ( υποθετικά στο μισό) σε σχέση με τον γενετικό τόπο του α γονιδίου 16p13.1(κάτω). Εάν υποθέσουμε ότι ο πρώτος γενετικός τόπος φέρει γονίδιο α που εκφράζεται και παράγει 50 μοναδες των αλυσίδων α, τότε ο δεύτερος θα παράγει 100 μονάδες από α σφαιρίνες.

Ένα παιδί του ζευγαριού IV1, IV2, που και οι δυο είναι υγιείς, παντρεύτηκε και απέκτησε δύο παιδιά. Το πρώτο παράγει 200 μονάδες αλυσίδων α και νοσεί από δρεπανοκυτταρική αναιμία, ενώ το δεύτερο παιδί του παράγει 250 μονάδες αλυσίδων α και σε συνθήκες υποξύας εμφανίζει συμπτώματα αναιμίας και δεν παράγει καθόλου HbA2.

Ποιοί είναι οι γόνοτυποι των γονέων των δυο αυτών παιδιών για την α θαλασσαιμία; (2)

Με ποιά πιθανότητα, οι γονείς αυτοί, μπορούν να αποκτήσουν παιδί που θα παράγει 250 μονάδες α σφαιρίνων και θα παράγει περίπου 3% HbA2, ενώ θα νοσεί και από μικροδρεπανοκυττταρική αναιμία; (2)

Β. Το γονίδιο lux της πυγολαμπίδας ενθέτεται σε έναν πλασμιδιακό φορέα κλωνοποίησης που φέρει γονίδιο ανθεκτικότητας στην τετρακυκλίνη (tetR), το οποίο με τη σειρά του φέρει θέση αναγνώρισης από την EcoRI, καθώς και το γονίδιο lacZ του οπερονίου της λακτόζης:

α) Εξηγήστε αν τα κύτταρα-ξενιστές που δέχθηκαν τον ανασυνδυασμένο φορέα κλωνοποίησης θα εμφανίζουν βιοφωταύγεια.( μονάδες 3)

β) Ποια ιδιότητα πρέπει να χαρακτηρίζει τα κύτταρα-ξενιστές (E.coli) ώστε να μπορεί να γίνει η επιλογή των μετασχηματισμένων με το ανασυνδυασμένο.   (μονάδες 2)

ΖΗΤΗΜΑ 4Ο

Α. Τα αλληλόμορφα α+, β+, γ+ και δ+ είναι ανεξάρτητα μεταξύ τους και ελέγχουν το σχηματισμό μαύρου χρώματος σε ένα ζώο. Τα αλληλόμορφα α, β, γ, δ είναι τα υπολειπόμενα τα οποία δεν εκφράζονται.

     Ένα μαύρο άτομο που είναι καθαρή σειρά διασταυρώθηκε με ένα λευκό άτομο και στην F1 γενεά όλοι οι απόγονοι ήταν μαύροι. Στη συνέχεια διασταυρώθηκαν τα άτομα της F1 γενεάς.

Γνωρίζετε ότι το μεταβολικό μονοπάτι είναι:

α+                                β+                             γ+                            δ+

ΛΕΥΚΟ    —>      ΛΕΥΚΟ     —>     ΛΕΥΚΟ   – –>       ΚΑΦΕ    —>     ΜΑΥΡΟ

α) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΛΕΥΚΟ;

β) Ποιο ποσοστό των απογόνων της F2 γενεάς θα είναι ΚΑΦΕ;                (μονάδες 5)

Β. Στο βακτήριο E.coli υπάρχει μία πρωτεΐνη με φυσιολογικό αμινοτελικό άκρο:                                         H2N – Met – Val – Ser – Ser – Pro – Met – Gly – Ala – Ala – Met – Ser …

Μία μετάλλαξη προκάλεσε αλλαγή στο αντικωδικόνιο ενός μορίου t

RNA  από 5΄- GAU – 3΄ σε 5΄- GAU – 3΄. Ποιο/α μπορεί να είναι τα πιθανά αμινοτελικά άκρα αυτής της πρωτεΐνης στα μεταλλαγμένα κύτταρα E.coli;               (μονάδες 5)

Γ. Δίνεται το παρακάτω γενεαλογικό δέντρο που αφορά την ασθένεια της μυοτονικής δυστροφίας.

2017 Διαγώνισμα προσομοίωσης Β-05

 

Η μυοτονική δυστροφία εμφανίζεται με βαθμιαία σοβαρότερα συμπτώματα από γενεά σε γενεά. Για να εξηγηθεί αυτή η παρατήρηση πραγματοποιήθηκαν μοριακές εξετάσεις στα άτομα Ι2, ΙΙ2 και ΙΙΙ2.

Οι αναλύσεις αυτές έδειξαν ότι ο ιχνηθετημένος ανιχνευτής 5΄CTGCTGCTGCTGCTG 3΄ υβρίδισε στο άτομο Ι2 10 φορές με το άτομο ΙΙ2 300 φορές και με το άτομο ΙΙΙ2 2000 φορές.

α) Ποια διασταύρωση του δοθέντος γενεαλογικού δέντρου αποδεικνύει τον τρόπο κληρονόμισης της ασθένειας; Ποιος είναι ο τύπος κληρονομικότητας;

(μονάδες 2)

β) Τα αποτελέσματα των μοριακών εξετάσεων σε ποιο συμπέρασμα οδηγούν για την αιτία της αυξανόμενης σοβαρότητας των συμπτωμάτων της ασθένειας από γενεά σε γενεά;

(μονάδες 3)

γ) Οι ανιχνευτές υβριδίζουν στην περιοχή της 3΄ αμετάφραστης περιοχής του υπεύθυνου για την ασθένεια γονιδίου. Ποιο από τα τρία διαφορετικά είδη κλωνοποίησης του γονιδίου αυτού μπορούν να χρησιμοποιήσουν οι επιστήμονες; Αιτιολογήστε με συντομία την απάντησή σας.

(μονάδες 3)

δ) Πώς ονομάζονται τα γονίδια που ευθύνονται για την ασθένεια στα άτομα Ι2, ΙΙ2 και ΙΙΙ2;

(μονάδα 1)

ε) Προτείνετε ένα πιθανό τύπο μετάλλαξης που μπορεί να εξηγήσει το διαφορετικό μέγεθος της 3΄ αμετάφραστης περιοχής του υπεύθυνου γονιδίου από γενεά σε γενεά εάν γνωρίζετε ότι είναι αποτέλεσμα μηχανισμού κατά τη διάρκεια του κυτταρικού κύκλου.

(μονάδα 1)

στ) Οι επιστήμονες θέλουν να εκθέσουν σε φορείς έκφρασης (πλασμίδια) τα γονίδια που ευθύνονται για την ασθένεια των ασθενών ατόμων της γενεαλογίας που σας δίνεται. Δίνεται ο περιοριστικός χάρτης του γονιδίου και δύο διαφορετικοί φορείς κλωνοποίησης. Ποια/ες περιοριστικές ενδονουκλεάσες θα χρησιμοποιήσουν οι επιστήμονες ώστε να εξασφαλίσουν των έκφραση των γονιδίων;

2017 Διαγώνισμα προσομοίωσης Β-06

2017 Διαγώνισμα προσομοίωσης Β-07

  1. Ποιος από τους δύο φορείς έκφρασης θα χρησιμοποιηθεί;
  2. Εξηγήστε για ποιο λόγο ο Υ1 του γονιδίου της AmpR είναι ο κατάλληλος για την έκφραση του ανθρώπινου γονιδίου.

(μονάδες 5)

Διαγώνισμα Προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2017

Ζήτημα.                                                                                                                         μονάδες 25

1.Τα χρωμοσώματα των ευκαρυωτικών οργανισμών είναι ουδέτερα τόσο χημικά όσο και ηλεκτρικά, αυτό σημαίνει ότι:

Α. οι ιστόνες είναι θετικά φορτισμένες και όξινες

Β. οι ιστόνες είναι αρνητικά φορτισμένες και όξινες

Γ. οι ιστόνες είναι θετικά φορτισμένες και βασικές

Δ. οι ιστόνες είναι αρνητικά φορτισμένες και βασικές

Ε. τίποτα από τα παραπάνω

Στ. όλα τα παραπάνω είναι δυνατά.

2. Στο εργαστήριο απομονώθηκαν παγκρεατικά κύτταρα και μυικά  κύτταρα ποντικού. Μέτα από κατάλληλα πειράματα προέκυψαν υβριδικά κύτταρα, στα οποία όταν δημιουργήθηκε η cDNA βιβλιοθήκη τους σε δυο διαφορετικές χρονικές στιγμές, πήραμε ώριμα mRNA που κωδικοποιούν  για ινσουλίνη και ώριμα mRNA που κωδικοποιούν για μυοσίνη την πρώτη φορά και ώριμα mRNA που κωδικοποιούν  κατά κύριο λόγο μόνο μυοσινη τη δεύτερη φορά.

Α. Τα υβριδικά κύτταρα μπορεί να προέκυψαν από την σύντηξη πυρήνων.

Β. τα υβριδικά κύτταρα μπορεί να προέκυψαν από απομάκρυνση του πυρήνα του παγκρεατικού πυρήνα και τοποθέτηση του πυρήνα του μυϊκού κυττάρου στο απύρηνο παγκρεατικό κύτταρο.

Γ. τα υβριδικά κύτταρα μπορεί να προέκυψαν από μεταφορά πρωτεϊνών μυϊκών κυττάρων σε παγκρεατικά.

Δ. τα υβριδικά κύτταρα εκφράζουν τα ίδια γονίδια κάθε χρονική στιγμή

Ε. το α ή το β

Στ. το γ ή το δ.

3. Δημιουργήθηκε ένας σύνθετος βακτηριοφάγος με πρωτεϊνικό καψίδιο του Τ4 και γενετικό υλικό του λ φάγου. Οι σύνθετοι αυτοί ιοί χρησιμοποιήθηκαν για την δημιουργία γονιδιωματικής βιβλιοθήκης του βακτηρίου A. tumefaciens. Η γονιδιωματική βιβλιοθήκη αποτελείται από:

Α. λ φάγους το DNA των οποίων είναι ανασυνδυασμένο με τμήμα από Ti πλασμίδιο και το χρωμόσωμα του βακτηρίου.

Β. Τ4 φάγους το γενετικό υλικό των οποίων είναι ανασυνδυασμένο με τμήματα από το ολικό DNA του βακτηρίου.

Γ. λ φάγους που φέρουν ανασυνδυασμένο γενετικό υλικό του Τ4 με τμήμα από το DNA του βακτηρίου δότη.

Δ. Τ4 φάγους και λ φάγους ο κάθε ιός με το δικό του DNA ανασυνδυασμένο με τμήμα από το γενετικό υλικό του βακτηρίου .

Ε. τίποτα από τα παραπάνω.

Στ. οποιοδήποτε από τα παραπάνω είναι μπορεί να είναι σωστό.

4. Δίνεται το ολιγόπεπτιδίο :

met-lys-pro-arg-ser-arg-ile-phe-glu-met

Το συνεχές γονίδιο που το κωδικοποιεί πέπτεται από την EcoRI. To μεταφράσιμο τμήμα της κωδικής αλυσίδας είναι:

Α. 5’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG3’

B  5.’ ATG-GAA-TTC-ATT-AGG-TCC-AGG-CCC-AAA-ATG3’

Γ. 5’ ATG-AAG-CTT-TTA-GGA-CCT-GGA-CCC-AAA-ATG3’

Δ. 3’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG5’

E. καμιά από τις παραπάνω επιλογές.

Στ. οποιαδήποτε από τις παραπάνω επιλογές.

5. Τα αντισώματα είναι πρωτεΐνες με τεταρτοταγή δομή αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δυο όμοιες. Δυο βαριές και δυο ελαφριές. Τα μη μονοκλωνικά αντισώματα είναι διαφορετικά μεταξύ τους μόνο σε ένα μικρό ακραίο τμήμα τόσο των βαρίων όσο και των ελαφριών αλυσίδων τους. Ο ανθρωπινός οργανισμός μπορεί να συνθέσει εκατομμύρια διαφορετικά αντισώματα. Τα μονοκλωνικά αντισώματα παράγονται με τεχνολογία υβριδωμάτων και όχι με γενετική μηχανική από γενετικά τροποποιημένα βακτήρια ή ευκαρυωτικά κύτταρα, διότι:

α. είναι πιθανόν αδύνατη η απομόνωση των δυο διαφορετικών ωρίμων mRNA από ένα β λεμφοκύτταρο που απαιτούνται για την cDNA βιβλιοθήκη.

Β. είναι πιθανόν αδύνατη η εκτέλεση των πολύπλοκων μετά-μεταφραστικών τροποποιήσεων που απαιτούνται από τα βακτήρια καθώς και η in vitro εκτέλεση τους.

Γ. για να γίνει η απομόνωση ωρίμων mRNA πρέπει να γνωρίζουμε τα γονίδια που τα κωδικοποιούν και αυτά δεν είναι μέχρι σήμερα γνωστά.

Δ. τίποτα από τα παραπάνω.

Ζήτημα 2.                                                                                                                     Μονάδες 25 

1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA  που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης Α και το βάζουμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση πρόδρομων β αλυσίδων της αιμοσφαιρίνης Α;  (μονάδες 2)              Αιτιολογήστε την απάντηση σας. (μονάδες 5)

2. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA αν ο γενετικός κώδικας δεν ήταν καθολικός; (μονάδες 7)

3.  Δώστε τον ορισμό της βιοτεχνολογίας. (μονάδες 6)

4. Δίνεται ο παρακάτω πινάκας, να γίνουν οι σωστές αντιστοιχήσεις. (μονάδες 5)

2017 Προσομοίωση πίνακας

Ζήτημα 3.                                                                                                                        Μονάδες 25

Σε μια προσπάθεια γεωπόνων βιοτεχνολόγων για την παραγωγή άνθεων με εντονότερο χρώμα, το δίκλωνο DNA που κωδικοποιεί την συνθετάση της χαλκόνης (ένζυμο υπεύθυνο για την παραγωγή μοβ χρωστικής των άνθεων της πετούνιας), τέθηκε υπό τον έλεγχο του πολύ ισχυρού υποκινητή 35S του ιού της μωσαϊκωσης (ιογενής ασθένεια) της πετούνιας, ο οποίος είχε ενθεθεί στο Ti. Στη συνεχεία, με τη βοήθεια του Ti πλασμίδιου και του βακτηρίου A. tumefanciens, το γονίδιο της συνθετάσης, μαζί με τον υποκινητή του ιού μεταφέρθηκε σε φυτά πετούνιας μοβ χρώματος. Το πλασμίδιο Ti, περιείχε γονίδιο ανθεκτικότητας στην καναμυκινή, για την επιλογή των φυτών που δέχθηκαν το ανασυνδυασμένο Ti. Το Ti έφερε μια θέση αναγνώρισης για το περιοριστικό ένζυμο EcoRI εντός του γονιδίου της ανθεκτικότητας στην καναμυκίνη.

Η υπερέκφραση του ενζύμου της συνθετάσης της χαλκόνης στην πετούνια, είχε ως αποτέλεσμα, όχι απαραιτήτως την παραγωγή άνθεων με βαθύτερο χρώμα, όπως θα περιμέναμε, αλλά και φυτών που έφεραν λευκά άνθη. Για να διαπιστωθεί το πρότυπο της κληρονόμησης  του ετερόλογου γονιδίου, έγινε ανάδρομη διασταύρωση των λευκών διαγονιδιακών απόγονων με το πατρικό φυτό, που έφερε ομοιόμορφα μοβ άνθη. Παραγόταν φυτά μοβ με ποσοστό 50% και φυτά λευκά κατά 50%. Ενώ από την διασταύρωση φυτών με βαθύ μοβ χρώμα και φυσιολογικών μοβ πήραμε 50% φυσιολογικά και 50% διαγονιδιακά μοβ.

Σημείωση: θεωρούμε ότι κάθε κύτταρο λαμβάνει από ένα πλασμίδιο Τi.

α. Περιγράψτε την διαδικασία με την οποία οι επιστήμονες δημιούργησαν διαγονιδιακά φυτά πετούνιας ξεκινώντας από την δημιουργία cDNA βιβλιοθήκης. (μονάδες 10)

β. Για ποιο λόγο το δίκλωνο ετερόλογο γονίδιο τέθηκε υπό τον έλεγχο του υποκινητή 35S του ιού της μωσαϊκώσης της πετούνιας όταν ενθέθηκε στο Ti πλασμίδιο, για ποιο λόγο δεν επιλέχθηκε ο υποκινητής του γονιδίου της χαλκόνης; (μονάδες 5)

γ. Δώστε την ερμηνεία για την μη αναμενόμενη εμφάνιση φαινοτύπων στα διαγονιδιακά φυτά. (μονάδες 10)

Ζήτημα 4.                                                                                                                Μονάδες 25

Δίνεται το παρακάτω γενεαλογικό δένδρο το οποίο αφορά την κληρονόμηση δυο ασθενειών στον άνθρωπο. Την ασθένεια του υποφυσιακού νανισμού και την συνδυασμένη εγκεφαλομυοπάθεια.

2017 Προσομοίωση-02

Προκείμενου να βρεθεί ο τρόπος κληρονόμησης της συνδυασμένης εγκεφαλομυοπάθειας πάρθηκε μυϊκός ιστός από το άτομο ΙΙΙ6, στον οποίο πραγματοποιήθηκε βιοψία και μοριακές αναλύσεις. Γνωρίζουμε ότι σύμφωνα με τις βιοψίες η ασθένεια της μυοπάθειας δεν εμφανίζει κανένα από τα γνωστά πρότυπα, ωστόσο, εμφανίζει τροποποιημένα μιτοχόνδρια, έτσι έγινε PCR ενίσχυση και πέψη με περιοριστικές ενδονουκλεάσες για τα γονίδια ND1 και ND6 του mtDNA.

Το φυσιολογικό ND1 γονίδιο δεν πέπτεται από την EcoRI, ενώ το παθολογικό αλληλόμορφο πέπτεται σε ένα σημείο. Η ίδια περιοριστική ενδονουκλεάση πέπτει το φυσιολογικό ανθρωπινό mtDNA σε ένα ακόμη σημείο.

Το φυσιολογικό αλληλόμορφο ND6 του mtDNA, πέπτεται από την PstI, ενώ το παθολογικό αλληλόμορφο όχι.

Στο ακόλουθο σχήμα δίνεται ο χάρτης περιορισμού του ανθρώπινου mtDNA, το οποίο έχει μέγεθος 17.000 ζ.β.

Δίνεται η θέση αναγνώρισης της PstI:

5’ CTGCAG3’

3’ GACGTC5’

2017 Προσομοίωση-03

Πάρθηκαν δείγματα από τα εξής άτομα της γενεαλογίας :

Ι1, Ι2, ΙΙ1, ΙΙ3, ΙΙ5, ΙΙΙ5, ΙΙΙ6, ΙΙΙ7

To mtDNA, κάθε ατόμου πέπτεται με EcoRI και PstI, ταυτόχρονα και πήραμε τα ακόλουθα αποτελέσματα. Το κυκλικό μόριο δεν εμφανίζεται.

2017 Προσομοίωση-04

Από περαιτέρω γενετικές μελέτες που έγιναν αποκλείστηκε οποιαδήποτε σχέση αυτόσωμικών γονιδίων με την μυοπάθεια.

α.Με ποιο τρόπο κληρονομείται η ασθένεια του υποφυσιακού νανισμού σύμφωνα με το γενεαλογικό δένδρο ποια διασταύρωση αποδεικνύει αυτόν τον τρόπο κληρονόμησης;      ( μονάδες 2)

β. προτείνεται ένα τρόπο κληρονόμησης ή εμφάνισης της μυοπάθειας στο άτομο που εμφανίζει τη νόσο (μονάδες 8). Με ποια πιθανότητα ένα επόμενο παιδί των ΙΙ5 και ΙΙ6 θα νοσεί (μονάδες 2);

γ. Σχεδιάστε τον περιοριστικό χάρτη του mtDNA του ατόμου Ι1 και του ατόμου Ι2 (μονάδες 3).

δ.Εξηγήστε ποια είναι η κωδική και η μη κωδική αλυσίδα των γονιδίων ND1 και ND6. Να προσδιοριστεί ο προσανατολισμός των κλώνων των δυο γονιδίων (μονάδες 6).

2017 Προσομοίωση-05

ε.Τι είδους μετάλλαξη φέρει το παθολογικό γονίδιο ND1 (μονάδες 1).

στ. Προσδιορίστε τον προσανατολισμό του μορίου mtDNA του ανθρώπου στο σημείο Α (εκατέρωθεν αυτού) (μονάδες 1).

ζ.Οι ασθένειες που μελετώνται έχουν τις προϋποθέσεις για την θεραπεία τους μέσω γονιδιακής θεραπείας (μονάδες 2);

Διαγώνισμα Προσομοίωσης 2016 Βιολογία Θετικού προσανατολισμού

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                   Μονάδες 25

Α1. Οι μονοκύτταροι οργανισμοί:

  1. είναι μόνο τα βακτήρια
  2. είναι δυνατόν να εμφανίζουν διαφοροποιημένα τμήματα
  3. έχουν μόνο κυκλικό/α δίκλωνα μόρια DNA
  4. έχουν πάντα οπερόνια και πλασμίδια
  5. αποκλείεται να έχουν μεμβρανώδη οργανίδια.

   Α2. Ένα άτομο που θα έχει δεχθεί γονιδιακή θεραπεία για την δρεπανοκυτταρική αναιμία:

  1. η αναλογία HbS/HbA στα ερυθροκύτταρα του αναμένεται ότι θα είναι 2:1
  2. σε ένα πρόδρομο ερυθροκύτταρό του θα υπάρχουν 4 διαφορετικές αιμοσφαιρίνες και 5 διαφορετικά γονίδια υπομονάδων των αιμοσφαιρινών
  3. θα εμφανίζει δρεπανοκύτταρα κατά τη δοκιμασία δρεπάνωσης
  4. δεν θα εμφανίζουν όλα του τα κύτταρα τον ίδιο γονότυπο
  5. όλα τα παραπάνω είναι σωστά.

Α3. Η αναλογία φαινοτύπων στην F2 γενεά, κατά το πρότυπο διασταυρώσεων του Mendel, 6:3:2:1 προκύπτει, όταν:

  1. Έχουμε διασταύρωση μονοϋβριδισμού
  2. Έχουμε διασταύρωση διϋβριδισμού με τα επικρατή γονίδια να είναι εμβρυακά θνησιγόνα
  3. Έχουμε διασταύρωση διϋβριδισμού με τα υπολειπόμενα γονίδια να είναι εμβρυακά θνησιγόνα
  4. Έχουμε διασταύρωση διυβριδισμού με ένα επικρατές και εμβρυακό θνησιγόνο γονίδιο.
  5. Τίποτα από τα παραπάνω

  Α4.  Με βάση τις αλυσίδες που σας δίνονται, οι οποίες αποτελούν το γενετικό υλικό ενός ιού, μπορείτε να συμπεράνετε ότι η μορφή του DNA του ιού, είναι:

  1. Μονόκλωνο γραμμικό,
  2. Δίκλωνο κυκλικό
  3. Μονόκλωνο κυκλικό
  4. Δίκλωνο γραμμικό
  5. τίποτα από τα παραπάνω

Ι: 5′ GCTCCTA3′             II: 5′ GGAGCTA3′

A5.Δίνονται τα δωδέκατα ζεύγη χρωμοσωμάτων του ανθρώπου που ανήκουν σε ένα ζευγάρι:

20160413_223336

  1. Το ζευγάρι έχει φυσιολογικό καρυότυπο
  2. Ο σύζυγος φέρει αμοιβαία μετατόπιση
  3. Η σύζυγος ευθύνεται για την απόκτηση παιδιών με ετερόζυγη έλλειψη
  4. ο σύζυγος έχει πιθανόν φυσιολογικό φαινότυπο άλλα όχι και φυσιολογικό καρυότυπο.
  5. Το ζευγάρι δεν μπορεί να αποκτήσει φυσιολογικούς απογόνους

 

 

Θέμα Β                                                                                         μονάδες 25

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τον Σεπτέμβριο του 1990 σε ένα κορίτσι τεσσάρων ετών που έπασχε από ανεπάρκεια του ανοσοποιητικού συστήματος. Η διαδικασία που ακολουθείται για την γονιδιακή θεραπεία της παραπάνω ασθενείας είναι η εξής:

Γράψτε τα επτά βήματα που περιγράφονται στην εικόνα.                     (μονάδες 7)Ex vivo

Β2. Εξηγήστε με ποιο τρόπο τα ογκοκατασταλτικά γονίδια σχετίζονται με την καρκινογένεση.                                                                             (μονάδες 5)

Β3. Εξηγήστε ότι το pH  του θρεπτικού υλικού ανάπτυξης μιας υγρή καλλιέργειας μικροοργανισμών επηρεάζει σημαντικά την ανάπτυξη της καλλιέργειας.                                                                                                                            (μονάδες 5)

Β4. Πώς συμβάλει η κλωνοποίηση στην προστασία των ζωικών ειδών που απειλούνται με εξαφάνιση;                                                                              (μονάδες 4)

Β5. Ποιοι ήταν δυο οι στόχοι του προγράμματος του ανθρώπινου γονιδιώματος;                                                                                                               (μονάδες 4)

Θέμα Γ                                                                                              μονάδες 25

Γ1. Επαναλαμβάνετε τα κλασσικά πειράματα του F. Griffith. Διαθέτετε τρεις δοκιμαστικούς σωλήνες με άγνωστα δείγματα (Α, Β, Γ) από στελέχη του βακτηρίου D. pneumoniae και θέλετε να τα χαρακτηρίσετε.

Μολύνετε με αυτά τα δείγματα, το καθένα μόνο του, και σε συνδυασμό μεταξύ τους, ποντίκια. Κατόπιν παίρνετε αίμα από τα ποντίκια και πραγματοποιείτε στερεή καλλιέργεια.

Τα αποτελέσματα των πειραμάτων σας είναι:

Αριθμός Δείγματος Δείγμα Ποντίκι Στερεή καλλιέργεια
1 Α νεκρό Ζωντανά λεία
2 Β ζωντανό κανένα
3 Γ ζωντανό Ζωντανά αδρά
4 Α+Β νεκρό Ζωντανά λεία
5 Α+Γ νεκρό Ζωντανά λεία και αδρά
6 Β+Γ νεκρό Ζωντανά λεία και αδρά

Κάθε δείγμα (Α,Β,Γ) περιεχέι μόνο ενα τύπο βακτηριακού στελέχους, να βρείτε το στέλεχος που υπάρχει σε κάθε δείγμα. Επιλέξτε από τα παρακάτω:

  1. Ζωντανά λεία-μολυσματικά
  2. θερμοθανατωμένα λεία-μολυσματικά
  3. ζωντανά αδρά- μη μολυσματικά
  4. θερμοθανατωμένα αδρά- μη μολυσματικά (μονάδες 3)

Γ2. Δίνεται το παρακάτω μεταβολικό μονοπάτι του ανθρώπινου οργανισμού.

Διαγώνισμα 2016-01

Η Αλκαπτονουρία είναι μια μεταβολική νόσος, που οφείλεται σε ανενεργότητα του ενζύμου ΕΑΚU που εμφανίζεται στο δοθέν μεταβολικό μονοπάτι με αποτέλεσμα να μην σχηματίζεται το προϊόν Γ.

α. Έστω ένα ομόζυγο άτομο για τα παθολογικά υπολειπόμενα αλληλόμορφα που ευθύνονται για την φαινυλκετονουρία και την αλκαπτονουρία (αυτοσωμική νόσος), θα περιμένατε να εμφανίζει συμπτώματα και για τις δύο ασθένειες;                (μονάδες 2)

β. Τα γονίδια που ευθύνονται για την σύνθεση των ενζύμων ΕAKU και ΕPKU και ΕM εδράζονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Ένα ζευγάρι που και οι δυο είναι ετερόζυγοι και για τις τρεις αυτές ασθένειες, πρόκειται να αποκτήσει το πρώτο του παιδί. Με ποια πιθανότητα αυτό το παιδί θα έχει φαινότυπο αλφικού ατόμου ή θα είναι υγιές;                                                                                                       (μονάδες 14)

Γ3. Στο τρυβλίο ανάπτυξης μιας αποικίας ενός στελέχους E. coli  έσταξε καφές. Παρατηρήθηκε κατόπιν ότι υπήρχαν κύτταρα, όπου ορισμένα μόρια tRNA με αντικωδικόνιο 5΄GUA3΄υπήρχαν σε μικρότερη  ποσότητα στα κύτταρα αυτά, όμως  υπήρχαν σε αυτά τα κύτταρα και μόρια tRNA με αντικωδικόνιο 5΄UUA3΄φορτισμενα με το ίδιο αμινοξύ, όπως εκείνα με αντικωδικόνιο 5′ GUA3′.

α. Η παρουσία των μεταλλαγμένων μορίων tRNA τι συνέπειες μπορεί να έχει για το κύτταρο;                                                                                           (μονάδες 4)

β. Ποια μπορεί να είναι η αίτια της παραγωγής αυτών των μορίων tRNA από το βακτηριακό κύτταρο; Δώστε μια πιθανή εξήγηση.                                 (μονάδες 2)

Δίνεται ο γενετικός κώδικας.

 

ΘΕΜΑ Δ                                                                                         (μονάδες 25)

 

Δ1. Μια cDNA βιβλιοθήκη, δημιουργήθηκε από ηπατικά κύτταρα ανθρώπου. Απομονώθηκε το δίκλωνο μόριο DNA από αυτήν την βιβλιοθήκη, το οποίο αντιπροσωπεύει το ώριμο mRNA και υποβλήθηκε σε πέψη με τα περιοριστικά ένζυμα:  EcoRI [E], HindIII [H], και BamHI [B].

Παρακάτω φαίνεται αυτό το μόριο και οι θέσεις αναγνώρισης των περιοριστικών ενζύμων πάνω σε αυτό (περιοριστικός χάρτης).

Από κύτταρα ήπατος του ίδιου ατόμου δημιουργήθηκε και η γονιδιωματική βιβλιοθήκη. Από αυτήν την βιβλιοθηκη (γονιδιωματική) απομονώθηκε το ιδιο γονίδιο, που έδωσε και την παραπάνω cDNA βιβλιοθήκη.

Διαγώνισμα 2016-02

α. Πολλές πρωτεΐνες μας παράγονται στο ήπαρ και δρουν σε άλλα όργανα μας. Αναφέρετε δύο ασθένειες του ανθρώπου που γνωρίζεται οι οποίες επηρεάζουν δυσμενώς  τους πνεύμονες.                                                                      (μονάδες 2)

β. Εξηγήστε για ποιο λόγο, διαφέρουν οι περιοριστικές θέσεις και το μέγεθος του ίδιου γονιδίου μεταξύ των δύο βιβλιοθηκών. Μπορούμε να συνάγουμε αν το γονίδιο, όπως απομονώθηκε απο την γονιδιωματική βιβλιοθήκη φέρει μάζι και τις ρυθμιστικές αλληλουχίες του;                                                 (μονάδες 5+3)

γ. Για μια νόσο του ανθρώπου που το γονίδιο το οποίο την ελέγχει εκφράζεται στο ήπαρ, αλλά η δράση της πρωτεΐνης που αυτό κωδικοποιεί εντοπίζεται στους πνεύμονες, επιχειρήθηκε η γονιδιακή θεραπεία και παραγωγή της φαρμακευτικής αυτής πρωτεΐνης που ευθύνεται, από διαγονιδιακα φυτά.

Ποια κύτταρα του ασθενούς πρέπει να δεχθούν την γονιδιακή θεραπεία;      (μονάδες 1)

δ. Η έκφραση της ανθρώπινης πρωτεΐνης πρέπει να γίνεται αποκλειστικά στα πράσινα μέρη του διαγονιδιακού  φυτού, τα οποία συλλέγονται εύκολα. Δίνεται το πλασμίδιο Ti  και το κλωνοποιημένο τμήμα DNA που περιεχέι το γονίδιο που μας ενδιαφέρει  από την γονιδιωματική βιβλιοθήκη.

Γονίδιο:

5΄TCCGGATCCCGGAATTCCAAGGCCT——-ATG————-TGA——CGTCGACTCCGGATCCC3′

3′ AGGCCTAGGGCCTTAAGGTTCCGGA——-TAC————-ACT——GCAGCTGAGGCCTAGGG5′

Πλασμίδιο Ti:

Διαγώνισμα 2016-03

Σημείωση: Στο γονίδιο της ανθεκτικότητας στην καναμυκινη, αντί για θεση περιορισμού EcoRI υπάρχει θεση περιορισμού  KpnI.

Υπόμνημα:

Υ1: Υποκινητής του γονιδίου της μικρής υπομονάδας της Rubisco (η μικρή υπομονάδα της Rubisco κωδικοποιείται στον πυρήνα και μεταφέρεται στους χλωροπλάστες οπού και συμμετέχει στην δομή της Rubisco).

Υ2: Υποκινητής  φυτικού αυτοσωμικού γονίδιου μεταγραφικού παράγοντα ενός γονιδίου που μετέχει στην φωτοσύνθεση.

Y3: Yποκινητής του χλωροπλαστικού γονιδίου που κωδικοποιεί για την Rubisco.

Υ4:Ισχυρός βακτηριακός υποκινητής

Tum(4): Ογκογενετικό γονίδιο του πλασμιδίου Ti

ΑΛΜ: Αλληλουχίες Λήξης της Μεταγραφής.

Περιοριστικές Ενδονουκλεάσες:

BamHI: 5′ G|GATCC3′    HindIII: 5′ A|AGCTT3′   StuI: 5′ AGG|CCT3′  SalI: 5′ G|TCGAC3′

HaeIII: 5΄GG|CC3′      AluI: 5΄AG|CT3′        KpnI: 5’GGTAC|C3′    NmaI: 5’T|CCGG3′

(Δίνεται ο ένας μόνο κλώνος κάθε δίκλωνης θέσης αναγνώρισης της κάθε περιοριστικής ενδονουκλεάσης καθώς και το σημείο που πέπτει την αλληλουχία αναγνώρισης της).

 

Ποιο γονίδιο από τα 1,2,3, 4 του πλασμιδίου Ti θα επιλεγεί για να ανασυνδυαστεί με το ανθρώπινο γονίδιο;                                                                  (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 2)

ε. Υπάρχουν δυο διαφορετικοί τρόποι ενθέσεις του ετερόλογου γονιδίου εντός του κατάλληλου γονιδίου του φορέα Ti  που δίνεται. Ποιοι είναι αυτοί;            (μονάδες 2)

στ. Ποια από τις δυο παραπάνω επιλογές θα οδηγήσει στην έκφραση του ανθρώπινου γονιδίου στα φυτικά κύτταρα;  Ποια επιλογή γονιδιου εξασφαλίζει  ότι όλα τα ανσυνδυασμενα φυτικά κύτταρα θα εκφράζουν την λειτουργική πρωτεινη;                                                     (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 3)

ζ. Με ποιο τρόπο μπορούμε ελέγξουμε αν πράγματι έχει παραχθεί η επιθυμητή ανθρώπινη πρωτεΐνη στα φύλλα του φυτού; Απλή αναφορά των τεχνικών που θα χρησιμοποιηθούν.                                                                     (μονάδες 3)

η. Ποια από τις δυο βιβλιοθήκες του ανθρώπου θα επιλέξουν οι επιστήμονες για την παραγωγή της φαρμακευτικής πρωτεΐνης από τα φύλλα του φυτού;           (μονάδες 2)

Καλή επιτυχία

Βιολογία Θετικής Κατεύθυνσης Διαγώνισμα Προσομοίωσης 2015

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                                                                                                                                                                                                                                                   Μονάδες 25

Α1. Στα πολυπεπτιδικά μόρια το πρώτο αμινοξύ:

  1. είναι πάντα η μεθείονινη
  2. έχει πάντα το αμινικό άκρο
  3. έχει πάντα το 3′ άκρο
  4. αφαιρείται μετα-μεταφραστικά πάντα
  5. αφαιρείται μετα-μεταγραφικά πάντα.

   Α2. Το βακτήριο Lactobacillus sp. όταν αναπτύσσεται σε θρεπτικό υλικό με ιχνηθετημένο άζωτο και διαιρείται, παράγονται:

  1. δυο μόρια DNA πλήρως ιχνηθετημένα
  2. ένα μόριο DNA ιχνηθετημένο και ένα όχι, όμοια μεταξύ τους
  3. δυο κλώνοι DNA συμπληρωματικοί μεταξύ τους άλλα που ανήκουν σε διαφορετικά μόρια.
  4. βακτήρια που δεν αναπτύσσονται σε περιβάλλον με pH μικρότερο του έξι
  5. βακτήρια που το DNA τους αποτελείται από δίκλωνα τμήματα DNA ιχνηθετημένα και όχι

Α3. Σε ένα χλωροπλάστη λαμβάνουν χώρα οι διαδικασίες:

Προσομοίωση θετικής 2015-03

V. όλα τα παραπάνω

   Α4. Ένα άτομο νόσει απο μια μιτοχονδριακή ασθένεια, το άτομο αυτό μπορεί να φέρει παθολογικό/α αλληλόμορφο/α για την νόσο αυτή :

  1. Στο μιτοχονδριακό DNA του μόνο
  2. στο μιτοχονδριακό και το πυρηνικό DNA του
  3. στο γονιδίωμα του
  4. στο γενετικό υλικό του πυρήνα μόνο
  5. μπορεί να ισχύει οτιδήποτε από τα παραπάνω

A5.Δίνονται τα παρακάτω γονίδια:

Προσομοίωση θετικής 2015-01

Όπου:3X: πλήθος νουκλεοτιδίων ακέραιο πολλαπλάσιο του τρία, Α.Λ.Μ: Αλληλουχίες Λήξης της Μεταγραφής.

Η κωδική αλυσίδα κάθε γονιδίου είναι:

  1. Ι=Β, ΙΙ=Γ, ΙΙΙ=Ζ, ΙV=Θ
  2. Ι=Β, ΙΙ=Δ, ΙΙΙ=Ζ, ΙV=Η
  3. Ι=Α, ΙΙ=Γ, ΙΙΙ=Ζ, ΙV=Θ
  4. Ι=Α, ΙΙ=Δ, ΙΙΙ=Ε, ΙV=Η
  5. Ι=Β, ΙΙ=Γ, ΙΙΙ=Ε, ΙV=Θ

Θέμα Β

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1.

α. Να περιγράψετε το πείραμα με το οποίο αποδείχθηκε ποιο συστατικό αποτελεί την αίτια μετασχηματισμού των βακτηρίων.

β. Τι γνωρίζεται για το γενετικό υλικό των προκαρυωτικών οργανισμών που υπάρχει σε όλα τα βακτήρια;                                                                                                                                                                                                                                                                       (μονάδες 2 +2)

Β2.

α. Τι είναι οι φαρμακευτικές πρωτεΐνες;

β. Τι γνωρίζεται για την δομή και τον φυσιολογικό ρόλο της ινσουλίνης;

γ. Ποια βήματα ακολουθούνται για την βιοτεχνολογική παραγωγή της λειτουργικής ινσουλίνης από προκαρυωτικά κύτταρα; Σύμφωνα με όσα γνωρίζεται θα μπορούσε να εφαρμοστεί η γονιδιακή θεραπεία του διαβήτη;                                                                                                                                                                                                                                                      (μονάδες 1 +3+4)

Β3. Τα κύτταρα ενός ευκαρυωτικού πολυκύτταρου οργανισμού, αν και φέρουν το ίδιο γενετικό υλικό διαφέρουν ως προς τη μορφή και την λειτουργία. Πώς επιτυγχάνεται αυτό;                                                                                                                                                                                 (μονάδες 3)

Β4.

α. Τι είναι ο καρκίνος;

β. Ποια είναι τα γονίδια που ευθύνονται για τη νόσο;

γ. Να αναφέρετε τρεις τρόπους θεραπείας για τον καρκίνο που είναι γνωστοί (απλή αναφορά)                                                                                                                                 (μονάδες 1+3+3)

Β5. Ποια είναι η μοναδική περίπτωση όπου παρατηρείται μεταφορά γενετικού υλικού από προκαρυωτικό κύτταρο σε ευκαρυωτικό κύτταρο στη φύση;                                                                                                                                                                                           (μονάδες 3)

Θέμα Γ

Να απαντήσετε στις παρακάτω ερωτήσεις

Γ1. Το παρακάτω γενεαλογικό δένδρο παρουσιάζει την κληρονόμηση της β-θαλασσαιμίας και της δρεπανοκυτταρικής αναιμίας σε μια γενεαλογία.

Προσομοίωση θετικής 2015-02

Υπόμνημα: Το άτομο Ι2 είναι ετερόζυγο για τα παθολογικά γονίδια β* και β^ και νοσεί από ήπια μορφή β θαλασσαιμίας.

Το άτομο Ι3 έχει γονότυπο β*β’ και νοσεί από βαρύτερης μορφής αναιμία.

Το άτομο ΙΙΙ1 νοσεί από δρεπανοκυτταρική αναιμία.

Το άτομο ΙΙΙ5 είναι ετερόζυγο για την δρεπανοκυτταρική αναιμία.

Τα άτομα Ι1 και Ι4 είναι αμιγή άτομα για το φυσιολογικό γονίδιο β.

Τα αλληλόμορφα β*, β^ και β΄ φέρουν σημειακή μετάλλαξη σε θέση μακριά από την θέση του 7ο κωδικονίου του φυσιολογικού γονιδίου β.

α. Τι είδους προβλήματα δημιουργούν τα δρεπανοκύτταρα;                                                                                                                                                                                                    (μονάδες 2)

β. Να υπολογιστεί το πλήθος των πιθανών διασταυρώσεων, σε επίπεδο γονοτύπου, για το ζευγάρι IV1 – IV2 που απαιτούνται για να υπολογιστεί η πιθανότητα το ζευγάρι να αποκτήσει απόγονο που νοσεί από αιμοσφαιρινοπάθεια β.

Σημείωση: Να μην υπολογιστεί η πιθανότητα.                                                                                                                                                                                                                           (μονάδες 8)

γ. Το παραπάνω ζευγάρι πραγματοποίησε προγεννετικό έλεγχο κατά την 13η εβδομάδα της κύησης ώστε να διαπιστωθεί ο γονότυπος του εμβρύου για το γονίδιο β. Με ποιο τρόπο έγινε η λήψη των εμβρυακών κυττάρων;                                                                                                                                                                                                                                                (μονάδες 2)

δ. Ποιες διαγνωστικές τεχνικές γνωρίζεται ότι διαθέτουμε για την διάγνωση της δρεπανοκυτταρικής αναιμίας και της β-θαλασσαιμίας; Ποιες από αυτές μπορούν να εφαρμοστούν στο έμβρυο;                                                                                                                                                                                                                                                                                                                  (μονάδες 5)

ε. Η περιοριστική ενδονουκλεάση ΑlmΙΙ αναγνωρίζει την αλληλουχία στο δίκλωνο DNA:

5′ C⌈TGTGAG 3′

3′ GACACT⌋C 5′

Δίνεται και το παρακάτω τμήμα DNA που περιεχέι τα κωδικόνια που κωδικοποιούν τα εννιά πρώτα αμινοξέα της αλυσίδας βς , που περιεχέι το αμινοξύ βαλίνη αντί για το γλουταμινικό οξύ, στο έκτο αμινοξύ της πολυπεπτιδίκης αλυσίδας β.

5’…ATG GTC ACC CCT GAA GCT GTG AGA AGC CAT….

…TAC CAG TGG GGA CTT CGA CAC TCT TCG GTA….

Στο εργαστήριο προγεννετικού έλεγχου που πραγματοποιήθηκε ο διαγνωστικός έλεγχος του εμβρύου χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση ΑlmΙΙ για την πέψη των γονιδίων β του εμβρύου που ενισχύθηκαν από την PCR.

Τα αποτελέσματα του έλεγχου έδειξαν ότι κανένα από τα δύο γονίδια β του εμβρύου δεν κόπηκε από την AlmΙΙ.

Ο διαγνωστικός έλεγχος έδειξε ότι το έμβρυο μετά την γέννηση του θα νοσεί ή δεν θα νόσει από δρεπανοκυτταρική αναιμία;                                                                                                               (μονάδες 2)

Ένα χρόνο μετά την γέννηση του ατόμου V1, το μωρό εμφανίζει συμπτώματα ατόμου ομόζυγου για την δρεπανοκυτταρική αναιμία και εμφάνισε θετική δοκιμασία δρεπάνωσης ενω προσδιορίστικε και στο αίμα του υψηλό ποσοστό HbS. Η επανάληψη της μοριακής εξέτασης με την περιοριστική ενδονουκλεάση Alm ΙΙ εμφάνισε την ίδια εικόνα που εμφάνισε και ως έμβρυο. Εξηγήστε τις παρατηρήσεις.                                                                                                                                   Δίνεται ο γενετικός κώδικας.                                                                                                                                                                                                                                         (μονάδες 6)

ΘΕΜΑ Δ

Να απαντήσετε στις παρακάτω ερωτήσεις

 Δ1. Σε μια περιοχή της Αφρικής για θρησκευτικούς λόγους απαγορεύεται η κατανάλωση ζωικών προϊόντων. Η διατροφή αυτών των ατόμων είναι πολύ περιορισμένη σε Τυροσίνη και λιγότερο σε Φαινυλαλανίνη. Από την διασταύρωση υγιών γονέων για τις ασθένειες της PKU και του αλφισμού, προκύπτουν απόγονοι με αναλογία 9:4:3, όταν οι γονείς αυτοί, είναι παιδιά ομόζυγων ατόμων για τις δυο αυτές ασθένειες, που ο ένας νοσεί μόνο από PKU και ο άλλος μόνο από αλφισμό. Εξηγήστε την αναλογία 9:4:3.                                                                                                         (μονάδες 8)

Δ2.

Δίνεται το γονίδιο yf το οποίο έχει μέγεθος 3kb (3000 ζ.β.). Το γονίδιο yf βρίσκεται στο πλασμίδιο pA. Θέλουμε να ανασυνδυάσουμε το γονίδιο yf στο πλασμίδιο pB. Τα πλασμίδιο pA και pB φαίνονται παρακάτω.

mit

Γνωρίζουμε ότι το λειτουργικό γονίδιο lacΖ κωδικοποιεί για το ένζυμο β-γαλακτοσιδάση, η οποία μπορεί να διασπά το άχρωμο συστατικό του θρεπτικού υλικού Χ-gal σε μια μπλε χρωστική οπότε οι βακτηριακές αποικίες θα είναι μπλε χρώματος.

α. Ποιο περιοριστικό ένζυμο θα χρησιμοποιηθεί για τον ανασυνδυασμό του γονιδίου yf με το pΒ; Όλες οι περιοριστικές ενδονουκλεάσες που δίνονται δημιουργούν μοναδικά κολλώδη άκρα. Αιτιολογήστε την απάντησή σας.                                                                                                                               (μονάδες 2+5)

β. Εξηγήστε με ποια δύο βήματα θα διακριθούν τα μετασχηματισμένα βακτήρια με το ανασυνδυασμένο πλασμίδιο από τα υπόλοιπα.                                                                                                             (μονάδες 5)

γ. Από τις αποικίες που σχηματίστηκαν επιλέχθηκαν 10 από τις οποίες απομονώθηκαν κύτταρα. Από τα κύτταρα αυτά, απομονώθηκαν τα pB πλασμίδια και αυτά πέμφθηκαν με BamHI. Τα προϊόντα της πέψης φαίνονται από παρακάτω πήκτωμα αγοράζης.

mit 2

  1. Ποια πλασμίδια δεν έχουν ανασυνδυαστεί;
  2. Ποια πλασμίδια έχουν ανασυνδυαστεί με το yf γονίδιο;

iii. Από τα πλασμίδια που έχουν ανασυνδύαστεί ποιο μπορεί να εκφράσει το yf και να παράγει την πρόδρομη πρωτεΐνη που αυτό κωδικοποιεί;

  1. Τι θα πρέπει να συμβεί για να παραχθεί η λειτουργική πρωτεΐνη;
  2. Στους κύκλους δεξιά του σχήματος προσθέστε τα σύμβολα +/- ,για να δείξετε τι είδους ηλεκτρικό φορτίο φέρουν τα μόρια του DNA.                                                                                                               (μονάδες 5)

Διαγώνισμα Προσομοίωσης 2014 Βιολογία Θετικής Κατεύθυνσης

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                                                                    Μονάδες 25

Α1. Γονίδια οργανωμένα σε οπερόνια μπορούμε να βρούμε στο γονιδίωμα:

  1. Του λ φάγου
  2. του αδενοϊου που θα χρησιμοποιηθεί ως φορέας για την γονιδιακή θεραπεία της κυστικής ίνωσης
  3. στον πυρήνα, στους μύκητες αρτοποιίας
  4. αποκλειστικά των προκαρυωτικών κυττάρων.

Α2. Ένα διαγονιδιακό ζώο που είναι ομόζυγο για το ανθρωπινό γονίδιο της α1 αντιθρυψίνης παράγει την ετερόλογη πρωτεΐνη στο γάλα του, εκφράζοντας και τα δυο ανθρωπινά γονίδια. Προκειμένου να εκφράζονται στο ζώο τα ανθρωπινά γονίδια, αυτά βρίσκονται υπό τον έλεγχο του ζωικού υποκινητή της καζεϊνης του γάλακτος μιας πρωτεΐνης που παράγει φυσιολογικά το ζώο.

Πόσους υποκινητές καζεΐνης του γάλακτος φέρει το διαγονιδιακό αυτό ζώο στο στάδιο της μετάφασης της μίτωσης;

  1. 2
  2. 6
  3. 8
  4. 12

Α3. Το γονίδιο που κωδικοποιεί για το μόριο tRNA με αντικωδικόνιο 5’CCA3′ έχει ως τμήμα κωδικής αλυσίδας:

  1. Υποκινητής:5΄…GCACGATGCAAGTTGATTGACAA…3′
  2. Υποκινητής:3’…CGCTACGGGCCCAGAACTTGATG…5′
  3. Υποκινητής:5’…GCAACCAATGAGATAACTTGTCTGA..3′
  4. Υποκινητής:5’…CGGACCGATGAAGTGGTAGCCTCG..3′

Α4. Ένα φυτό με όγκους στον κορμό του είναι:

  1. γενετικώς τροποποιημένο
  2. υγιές φυσιολογικό
  3. μολυσμένο από το βακτήριο του εδάφους Bacillus thurigiencies
  4. μολυσμένο από το βακτήριο Agrobacterium tumefaciens

A5.Δίνεται η παρακάτω θέση έναρξης της αντιγραφής του DNA σε ένα χρωμόσωμα και δίνεται και η αλληλουχία της περιοχής 1και 2:

Print

5’…CTGACTGACA…3′ (περιοχή 1, αλυσίδα 1)

3’…GACTGACTGT…5′ (περιοχή 2, αλυσίδα 2)

Έστω ότι ένα πρωταρχικό τμήμα δημιουργείται εντός της περιοχής 1 αυτό θα έχει αλληλουχία:

  1. 5′ GACTGACTGT3′
  2. 5′ UGUCAGUCAG3′
  3. 5′ CUGACUGACA3′
  4. 5’CTGACTGACA3′

Θέμα Β

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Ποιες δυνατότητες μας δίνει η κατασκευή βιβλιοθηκών; Ποιες εφαρμογές βρίσκει η μέθοδος της αλυσιδωτής αντιδράσεις πολυμεράσης;                                       (μονάδες4 +4)

Β2. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;                                                                                                                                                 (μονάδες 7)

Β3. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα; Για ποιους λόγους η μελέτη της διαδικασίας της αντιγραφής του γενετικού υλικού πραγματοποιείται στο βακτήριο E. coli ;                                                                                                         (μονάδες 4+2)

Β4. Να οριστεί η έννοια του γονιδίου.                                                                       (μονάδες 4)

Θέμα Γ

Γ1. Σε ένα πείραμα εξετάζεται η ενεργότητα του ενζύμου β-γαλακτοσιδάση. Η ενεργότητα του ενζύμου υπολογίζεται με την ικανότητα ανάπτυξης βακτηρίων E.coliσε θρεπτικό υλικό που περιεχέι X-gal και IPTG ή λακτόζη. Το X-galειναι ένα ανάλογο της λακτόζης το οποίο μετατρέπεται σε μπλε όταν μεταβολίζεται από την β-γαλακτοσιδάση όμως δεν επάγει την έκφραση του οπερονίου της λακτόζης. Το IPTG είναι ένα άλλο ανάλογο της λακτόζης που προκαλεί έκφραση του οπερονίου της αλλά δεν μεταβολίζεται από τα προϊόντα του οπερονίου της λακτόζης. Τέλος η γαλακτόζη μεταβολίζεται όπως και η γλυκόζη αλλά δεν επάγει την έκφραση του οπερονίου της λακτόζης.

Print

Μετά από τυχαία μεταλλαξιγέννεση που πραγματοποιήθηκε σε φυσιολογικό στέλεχος E. coli δημιουργήθηκε μεταλλαγμένο στέλεχος που αδυνατεί να δώσει μπλε αποικίες όπως φαίνεται παρακάτω.

Το στέλεχος έχει χάσει μόνο μια λειτουργιά είτε έχει μεταλλαχθεί το ρυθμιστικό γονίδιο του οπερονίου, είτε έχει μεταλλαχθεί ο υποκινητής αυτού, είτε έχει μεταλλαχθεί ο χείριστης του οπερονίου της λακτόζης, είτε ο υποκινητής του, είτε τέλος έχει μεταλλαχθεί το δομικό γονίδιο Ζ του οπερονίου της λακτόζης.

Στελέχη Ε.coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal + 

 

Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη+γαλακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 1 Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες

 

 

α. Στο παραπάνω μεταλλαγμένο στέλεχος βακτηρίου ποια από τις αναφερόμενες αλληλουχίες του γονιδιώματος του μπορεί να έχει υποστεί μετάλλαξη ώστε να εμφανίζεται ο μεταλλαγμένος φαινότυπος;                                                              μονάδες 3

β. Ένα διαφορετικά μεταλλαγμένο στέλεχος του βακτηρίου που προέκυψε από την μεταλλαξιγέννεση εμφανίζει τον παρακάτω φαινότυπο: 

Στελέχη E.. coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal +  Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 2 Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες

 

Το μεταλλαγμένο αυτό στέλεχος φέρει μετάλλαξη σε ένα μόνο συστατικό του οπερονίου της λακτόζης ή του ρυθμιστικού του γονιδίου. Ποια από αυτές τις αλληλουχίες μπορεί να έχει υποστεί μετάλλαξη για να εμφανίζεται αυτός ο φαινότυπος;                            μονάδες 3

γ. Το μεταλλαγμένο στέλεχος βακτηρίων του ερωτήματος β μετασχηματίστηκε με τα φυσιολογικά δομικά γονίδια του οπερονίου της λακτόζης και τον υποκινητή τους καθώς και με το φυσιολογικό ρυθμιστικό γονίδιο και τον υποκινητή του. Ωστόσο τα μεταλλαγμένα στελέχη εξακολουθούν να εμφανίζουν τον ίδιο φαινότυπο όπως και πριν τον μετασχηματισμό τους. Σε ποιο συμπέρασμα μπορούμε να οδηγηθούμε ως προς τον προσδιορισμό του τμήματος του γονιδιώματος που υπέστει την μετάλλαξη κατά την μεταλλαξιγέννεση; Αιτιολογήστε την απάντηση σας.                                      μονάδες 1+6 

Γ2. Το φυτό Α εμφανίζει ανθεκτικότητα στην προσβολή του από ένα είδος κάμπιας. Το ίδιο είδος κάμπιας προσβάλει και μια εμπορική ποικιλία καλαμποκιού. Στο γονιδίωμα του φυτού Α χαρτογραφήθηκε, απομονώθηκε και κλωνοποίηθηκε το αυτό το γονίδιο ανθεκτικότητας.

Οι γεωπόνοι θέλουν να δημιουργήσουν μια εμπορική ανθεκτική ποικιλία καλαμποκιού σε αυτό το είδος κάμπιας. Με δεδομένο ότι τα δυο είδη φυτών είναι συγγενικά αναμένεται να είναι δυνατή η έκφραση του ετερόλογου γονιδίου του φυτού Α στο καλαμπόκι, όταν το γονίδιο της ανθεκτικότητας στις κάμπιες ενθέτεται στο γονιδίωμα του καλαμποκιού μαζί με την ρυθμιστική αλληλουχία του.

α,Έχοντας στην διάθεση σας τους χάρτες με τις θέσεις περιορισμού του πλασμίδιο Τi και του γονιδίου ανθεκτικότητας στις κάμπιες του φυτού Α, ποιο περιοριστικό ένζυμο θα επιλέγατε για τον ανασυνδυασμό του πλασμιδίου Ti, με το συγκεκριμένο γονίδιο;                                                                                                                                              μονάδες 2

Print 

β. Πώς το πλασμίδιο Ti του βακτηρίου Agrobacterium tumefaciens επιτρέπει την δημιουργία διαγονιδιακών φυτών;                                                                               μονάδες 7

γ. Απο ποιο είδος βιβλιοθήκης θα επιλέξουμε το γονίδιο της τοξίνης του βακτηρίου Bacillus thurigiensisγια την δημιουργία φυτών καλαμποκιού Bt;                          μονάδες 3

 ΘΕΜΑ Δ

 Δ1. Από την διασταύρωση δυο εντόμων Drosophilla, που και τα δυο είχαν μακριά φτερά και κόντες κεραίες προέκυψαν οι παρακάτω απόγονοι.

Άτομα F1 Γενεάς
420 με μακριά φτερά και κόντες κεραίες
211 με μακριά φτερά και μεγάλες κεραίες
206 με κοντά φτερά και κόντες κεραίες
98 με κοντά φτερά και μεγάλες κεραίες

Θεωρώντας ότι ο φυλοκαθορισμός στα έντομα αυτά προσδιορίζεται όπως και στον άνθρωπο και με δεδομένο ότι οι δυο χαρακτήρες που εξετάζονται είναι ανεξάρτητοι, να ερμηνευθούν τα αποτελέσματα ποu προέκυψαν.                                        Μονάδες 10

Δ2. Τα γονίδια β και γ των αιμοσφαιρινών μας είναι αυτοσωμικά και εδράζονται σε διαδοχικούς γενετικούς τόπους στο ίδιο ζεύγος ομολόγων χρωμοσωμάτων.

Ένας άνδρας ετερόζυγος και για τα δυο γονίδια και η σύζυγος του επίσης ετερόζυγη και για τα δυο γονίδια έχουν ιστορικό τριών συνεχόμενων πρωίμων αποβολών στην προσπάθεια τους για να τεκνοποιήσουν.

α. Ποιοι είναι οι πιθανοί γονότυποι των συζύγων αυτών;                             Μονάδες 3

β. Πώς μπορούν να εξηγηθούν οι πρώιμες αποβολές σε αυτό το ζευγάρι                                                                                                                               Μονάδες 4

γ. Η γυναίκα κυοφορεί και βρίσκεται στην 13η εβδομάδα της κύησης. Ποια μέθοδος λήψης εμβρυακών κυττάρων για την πραγματοποίηση προγεννητικού έλεγχου μπορεί να εφαρμοστεί σε αυτό το στάδιο της κύησης;

Ποια τεχνική διάγνωσης μπορεί να εφαρμοστεί στα κύτταρα του εμβρύου που ελήφθησαν ώστε να προσδιοριστεί αν το παιδί θα νοσεί από β-θαλασσαίμια;

Με ποια πιθανότητα αυτό είναι ομόζυγο για το παθολογικό αλληλόμορφο του γονιδίου γ;                                                                                                                                Μονάδες 1+1+1

δ. Το έμβρυο διαπιστώθηκε ότι είναι υγιές και ομόζυγο για τα γονίδια β και γ της αιμοσφαιρίνης Α και F αντίστοιχα, ποια είναι η πιθανότητα το επόμενο παιδί του ζευγαριού που θα γεννηθεί να είναι και αυτό υγιές; Αιτιολογήστε την απάντηση σας.                                                                                                                                         Μονάδες 5

Καλή επιτυχία

Διαγώνισμα προσομοίωσης Βιολογία θετικής 2013

Ζήτημα 1ο Μονάδες 25

1. Η αποικία είναι:
Α. Ορατή με γυμνό οφθαλμό.
Β. Ένα σύνολο από μικροοργανισμούς που ανήκουν σε διαφορετικά είδη.
Γ. Κλώνοι μικροοργανισμών που περιέχουν διαφορετικό ετερόλογο τμήμα DNA ο καθένας.
Δ. Τίποτα από τα παραπάνω.
(Μονάδες 5)

2. Η γαλακτόζη είναι:
Α. Απαραίτητη για την επιβίωση του βακτηρίου E.coli
Β. Διασπάται από τα ένζυμα που κωδικοποιεί το οπερόνιο της λακτόζης.
Γ. Συστατικό της γλυκόζης.
Δ. Μονοσακχαρίτης.
(Μονάδες 5)

3. Στο γονίδιο της αλυσίδας β της HbS, το έβδομο κωδικόνιο είναι το:
Α. Το 5’GAG3’
Β. Το 3’GAG5’
Γ. Το 5’GTG3’
Δ. Το 3’GCG5’
(Μονάδες 5)

4. Στον καρυότυπό μας το πλήθος των γονιδίων των αιμοσφαιρινών, είναι:
Α. 12
Β. 20
Γ. 6
Δ. 10
(Μονάδες 5)

5. Η κυστεϊνη που μεταφέρεται από ένα μόριο tRNA μετά από χημική επεξεργασία μπορεί να αλλάξει σε αλανίνη. Αν κάποια από αυτά τα τροποποιημένα tRNA προστεθούν σε κυτταρικό εκχύλισμα σύνθεσης πρωτεϊνών που περιέχει όλα τα απαραίτητα στοιχεία που απαιτούνται για τη φυσιολογική μετάφραση, ποιο από τα παρακάτω είναι το πιθανότερο μετά την προσθήκη mRNA που έχει κωδικόνια τόσο κυστεϊνης, όσο και αλανίνης΄;
Α. Κυστεϊνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου αλανίνης.
Β. Η αλανίνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου της κυστεϊνης.
Γ. Η πρωτεΐνη μπορεί να έχει λιγότερες κυστεϊνες.
Δ. Η πρωτεΐνη που θα προκύψει θα είναι φυσιολογική.
(Μονάδες 5)

Ζήτημα 2ο

1. Το 1944 πραγματοποιήθηκε ένα ιστορικό πείραμα για την Βιολογία. Σε ποια συμπεράσματα οδήγησε αυτό το πείραμα;
(Μονάδες 3)
Ποια άλλα βιοχημικά δεδομένα της εποχής υποστηρίζουν τα δεδομένα αυτού του πειράματος;
(Μονάδες 3)
2. Στο γάλα των διαγονιδιακών ζώων μπορούν να εκκρίνονται φαρμακευτικές πρωτεΐνες. Ποια γνωρίζεται ότι είναι η πιο επιτυχημένη εφαρμογή παράγωγης τέτοιων πρωτεϊνών από ζώα;
(Μονάδες 8)
3. Ποια διαδικασία ακολουθήθηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993;
(Μονάδες 6)
4. Περιγράψτε το πρότυπο των πειραμάτων του Mendel, τα αποτελέσματα των οποίων τον οδήγησαν στη διατύπωση των νόμων της κληρονομικότητας;
(Μονάδες 5)
Ζήτημα 3ο

Α. Ένα ευκαρυωτικό κύτταρο που περιέχει 0,8ng μη ραδιενεργό φωσφόρο στο μοναδικό χρωμόσωμα που διαθέτει, όταν τοποθετείται σε θρεπτικό υλικό που περιέχει κατά 50% μη ραδιενεργό φώσφορο και κατά 50% ραδιενεργό φωσφόρο, πολλαπλασιάζεται. Να βρεθούν τα ng του ραδιενεργού και του μη ραδιενεργού φωσφόρου (θεωρούμε ότι δεν υπάρχει διαφορά μάζας μεταξύ ραδιενεργού και μη ραδιενεργού φωσφόρου) που θα υπάρχουν στο γενετικό υλικό των κυττάρων που θα προκύψουν:
α. Μετά τον πρώτο διπλασιασμό του αρχικού κυττάρου.
(Μονάδες 3)
β. Μετά το δεύτερο διπλασιασμό που θα συμβεί σε αυτό το θρεπτικό υλικό.
(Μονάδες 3)

γ. Το παραπάνω πείραμα χαρακτηρίζεται ως in vivo ή ως in vitro; (Μονάδες 1)

Β. Το ρυθμιστικό γονίδιο του οπερονίου της λακτόζης στο βακτήριο E.coli έχει την παρακάτω υποθετική αλληλουχία ζευγών νουκλεοτιδίων. Ένα βακτηριακό στέλεχος έχει υποστεί μετάλλαξη στο ρυθμιστικό γονίδιο το οπερονίου της λακτόζης, με συνέπεια να παράγονται μόρια καταστολέα τα οποία συνδεονται πολύ ισχυρά με τον χειριστη.

Φυσιολογικό γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG

Μεταλλαγμένο γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAATAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTATTCAGCCCGTACTTAAGAG

α. Εξηγείστε ποιός θα είναι ο φαινότυπος του συγκεκριμένου στελέχους σε περιβάλλον με μοναδική πηγή άνθρακα τη γλυκόζη (Μονάδες 3) και σε περιβάλλον με μοναδική πηγή άνθρακα τη λακτόζη (Μονάδες 3).

β. Εντοπίστε το είδος της μετάλλαξης που έχει συμβεί (Μονάδες 1) και εξηγείστε με ποιό τρόπο αυτή επηρεάζει το γονιδιακό προϊόν (Μονάδες 3).

γ. Οι επιστήμονες τροποποίησαν γενετικά το συγκεκριμένο βακτηριακό στέλεχος , το οποίο στερείται πλασμιδίων και περιοριστικών ενζύμων, με το φυσιολογικό ρυθμιστικό γονίδιο.
Έχοντας στη διάθεσή τους τις περιοριστικές ενδονουκλεάσες (EcoRI, TruqI, TscI)και φορείς κλωνοποίησης, εξηγήστε ποια περιοριστική ενδονουκλεάση και ποιος φορέας κλωνοποίησης θα επιλεγεί για τον μετασχηματισμό.
(Μονάδες 1)
Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
Διαγώνισμα 2

δ. Το μετασχηματισμένο βακτηριακό στέλεχος αναπτύχθηκε σε θρεπτικό υλικό με μοναδική πηγή άνθρακα τη λακτόζη, μαζί με το φυσιολογικό στέλεχος του βακτηρίου, πώς θα γίνει δυνατή η διάκριση των δύο στελεχών;
Το φυσιολογικό στέλεχος στερείται πλασμιδίων.
(Μονάδες 4)

Ζήτημα 4ο

Το παρακάτω γενεαλογικό δένδρο αφορά την ασθένεια της οικογενούς υπερχοληστερολαιμίας
Διαγώνισμα 1

α. Με ποιό τύπο κληρονομικότητας γνωρίζεται ότι κληρονομείται η παρακάτω νόσος;
(Μονάδες 1)
Ποια διασταύρωση του δένδρου αποδεικνύει αυτόν τον τύπο κληρονομικότητας και ποια τον αποκλείει (Μονάδες 2); Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
β. Το ζευγάρι ΙΙΙ1 και ΙΙΙ2 ζήτησε γενετική καθοδήγηση σχετικά με το αν πρόκειται να αποκτήσουν απόγονο με οικογενή υπερχοληστερολαιμία.
Τι είναι η γενετική καθοδήγηση;
(Μονάδες 3)
Ποιες είναι οι προϋποθέσεις που πρέπει να διαθέτει ο ειδικός επιστήμονας ώστε να συμβουλέψει τους ενδιαφερόμενους;
(Μονάδες 3)
Ποια ήταν η απάντηση του ειδικού επιστήμονα στο ζευγάρι;
(Μονάδες 1)
γ. Το παιδί IV1 γεννήθηκε και νοσεί από οικογενή υπερχοληστεριναιμία. Από τις διαγνωστικές εξετάσεις που έγιναν διαπιστώθηκε ότι οι γονείς έχουν φυσιολογικό καρυότυπο και το παιδί έχει φυσιολογικό αριθμό χρωμοσωμάτων, αλλά φέρει το ένα από τα δύο αντίγραφα του γονιδίου που ελέγχει για την ασθένεια, μαζί με γειτονικούς του γενετικούς τόπους, σε διαφορετικά χρωμοσώματα από το χρωμόσωμα που φέρεται φυσιολογικά ο γενετικός τόπος του γονιδίου.
Τι είδους μετάλλαξη φέρει το παιδί;
(Μονάδες 2)
Πώς εξηγείται η γέννηση του παιδιού IV1 το οποίο εκφράζει το παθολογικό επικρατές αλληλόμορφο για την νόσο, από υγιείς γονείς, δηλαδή ομόζυγους για το υπολειπόμενο φυσιολογικό αλληλόμορφο για την ασθένεια, αποκλείοντας την γονιδιακή μετάλλαξη;
(Μονάδες 10)