Category Archives: Διαγωνίσματα Προσομοίωσης

Διαγώνισμα Προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2017

Ζήτημα.                                                                                                                         μονάδες 25

1.Τα χρωμοσώματα των ευκαρυωτικών οργανισμών είναι ουδέτερα τόσο χημικά όσο και ηλεκτρικά, αυτό σημαίνει ότι:

Α. οι ιστόνες είναι θετικά φορτισμένες και όξινες

Β. οι ιστόνες είναι αρνητικά φορτισμένες και όξινες

Γ. οι ιστόνες είναι θετικά φορτισμένες και βασικές

Δ. οι ιστόνες είναι αρνητικά φορτισμένες και βασικές

Ε. τίποτα από τα παραπάνω

Στ. όλα τα παραπάνω είναι δυνατά.

2. Στο εργαστήριο απομονώθηκαν παγκρεατικά κύτταρα και μυικά  κύτταρα ποντικού. Μέτα από κατάλληλα πειράματα προέκυψαν υβριδικά κύτταρα, στα οποία όταν δημιουργήθηκε η cDNA βιβλιοθήκη τους σε δυο διαφορετικές χρονικές στιγμές, πήραμε ώριμα mRNA που κωδικοποιούν  για ινσουλίνη και ώριμα mRNA που κωδικοποιούν για μυοσίνη την πρώτη φορά και ώριμα mRNA που κωδικοποιούν  κατά κύριο λόγο μόνο μυοσινη τη δεύτερη φορά.

Α. Τα υβριδικά κύτταρα μπορεί να προέκυψαν από την σύντηξη πυρήνων.

Β. τα υβριδικά κύτταρα μπορεί να προέκυψαν από απομάκρυνση του πυρήνα του παγκρεατικού πυρήνα και τοποθέτηση του πυρήνα του μυϊκού κυττάρου στο απύρηνο παγκρεατικό κύτταρο.

Γ. τα υβριδικά κύτταρα μπορεί να προέκυψαν από μεταφορά πρωτεϊνών μυϊκών κυττάρων σε παγκρεατικά.

Δ. τα υβριδικά κύτταρα εκφράζουν τα ίδια γονίδια κάθε χρονική στιγμή

Ε. το α ή το β

Στ. το γ ή το δ.

3. Δημιουργήθηκε ένας σύνθετος βακτηριοφάγος με πρωτεϊνικό καψίδιο του Τ4 και γενετικό υλικό του λ φάγου. Οι σύνθετοι αυτοί ιοί χρησιμοποιήθηκαν για την δημιουργία γονιδιωματικής βιβλιοθήκης του βακτηρίου A. tumefaciens. Η γονιδιωματική βιβλιοθήκη αποτελείται από:

Α. λ φάγους το DNA των οποίων είναι ανασυνδυασμένο με τμήμα από Ti πλασμίδιο και το χρωμόσωμα του βακτηρίου.

Β. Τ4 φάγους το γενετικό υλικό των οποίων είναι ανασυνδυασμένο με τμήματα από το ολικό DNA του βακτηρίου.

Γ. λ φάγους που φέρουν ανασυνδυασμένο γενετικό υλικό του Τ4 με τμήμα από το DNA του βακτηρίου δότη.

Δ. Τ4 φάγους και λ φάγους ο κάθε ιός με το δικό του DNA ανασυνδυασμένο με τμήμα από το γενετικό υλικό του βακτηρίου .

Ε. τίποτα από τα παραπάνω.

Στ. οποιοδήποτε από τα παραπάνω είναι μπορεί να είναι σωστό.

4. Δίνεται το ολιγόπεπτιδίο :

met-lys-pro-arg-ser-arg-ile-phe-glu-met

Το συνεχές γονίδιο που το κωδικοποιεί πέπτεται από την EcoRI. To μεταφράσιμο τμήμα της κωδικής αλυσίδας είναι:

Α. 5’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG3’

B  5.’ ATG-GAA-TTC-ATT-AGG-TCC-AGG-CCC-AAA-ATG3’

Γ. 5’ ATG-AAG-CTT-TTA-GGA-CCT-GGA-CCC-AAA-ATG3’

Δ. 3’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG5’

E. καμιά από τις παραπάνω επιλογές.

Στ. οποιαδήποτε από τις παραπάνω επιλογές.

5. Τα αντισώματα είναι πρωτεΐνες με τεταρτοταγή δομή αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δυο όμοιες. Δυο βαριές και δυο ελαφριές. Τα μη μονοκλωνικά αντισώματα είναι διαφορετικά μεταξύ τους μόνο σε ένα μικρό ακραίο τμήμα τόσο των βαρίων όσο και των ελαφριών αλυσίδων τους. Ο ανθρωπινός οργανισμός μπορεί να συνθέσει εκατομμύρια διαφορετικά αντισώματα. Τα μονοκλωνικά αντισώματα παράγονται με τεχνολογία υβριδωμάτων και όχι με γενετική μηχανική από γενετικά τροποποιημένα βακτήρια ή ευκαρυωτικά κύτταρα, διότι:

α. είναι πιθανόν αδύνατη η απομόνωση των δυο διαφορετικών ωρίμων mRNA από ένα β λεμφοκύτταρο που απαιτούνται για την cDNA βιβλιοθήκη.

Β. είναι πιθανόν αδύνατη η εκτέλεση των πολύπλοκων μετά-μεταφραστικών τροποποιήσεων που απαιτούνται από τα βακτήρια καθώς και η in vitro εκτέλεση τους.

Γ. για να γίνει η απομόνωση ωρίμων mRNA πρέπει να γνωρίζουμε τα γονίδια που τα κωδικοποιούν και αυτά δεν είναι μέχρι σήμερα γνωστά.

Δ. τίποτα από τα παραπάνω.

Ζήτημα 2.                                                                                                                     Μονάδες 25 

1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA  που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης Α και το βάζουμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση πρόδρομων β αλυσίδων της αιμοσφαιρίνης Α;  (μονάδες 2)              Αιτιολογήστε την απάντηση σας. (μονάδες 5)

2. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA αν ο γενετικός κώδικας δεν ήταν καθολικός; (μονάδες 7)

3.  Δώστε τον ορισμό της βιοτεχνολογίας. (μονάδες 6)

4. Δίνεται ο παρακάτω πινάκας, να γίνουν οι σωστές αντιστοιχήσεις. (μονάδες 5)

2017 Προσομοίωση πίνακας

Ζήτημα 3.                                                                                                                        Μονάδες 25

Σε μια προσπάθεια γεωπόνων βιοτεχνολόγων για την παραγωγή άνθεων με εντονότερο χρώμα, το δίκλωνο DNA που κωδικοποιεί την συνθετάση της χαλκόνης (ένζυμο υπεύθυνο για την παραγωγή μοβ χρωστικής των άνθεων της πετούνιας), τέθηκε υπό τον έλεγχο του πολύ ισχυρού υποκινητή 35S του ιού της μωσαϊκωσης (ιογενής ασθένεια) της πετούνιας, ο οποίος είχε ενθεθεί στο Ti. Στη συνεχεία, με τη βοήθεια του Ti πλασμίδιου και του βακτηρίου A. tumefanciens, το γονίδιο της συνθετάσης, μαζί με τον υποκινητή του ιού μεταφέρθηκε σε φυτά πετούνιας μοβ χρώματος. Το πλασμίδιο Ti, περιείχε γονίδιο ανθεκτικότητας στην καναμυκινή, για την επιλογή των φυτών που δέχθηκαν το ανασυνδυασμένο Ti. Το Ti έφερε μια θέση αναγνώρισης για το περιοριστικό ένζυμο EcoRI εντός του γονιδίου της ανθεκτικότητας στην καναμυκίνη.

Η υπερέκφραση του ενζύμου της συνθετάσης της χαλκόνης στην πετούνια, είχε ως αποτέλεσμα, όχι απαραιτήτως την παραγωγή άνθεων με βαθύτερο χρώμα, όπως θα περιμέναμε, αλλά και φυτών που έφεραν λευκά άνθη. Για να διαπιστωθεί το πρότυπο της κληρονόμησης  του ετερόλογου γονιδίου, έγινε ανάδρομη διασταύρωση των λευκών διαγονιδιακών απόγονων με το πατρικό φυτό, που έφερε ομοιόμορφα μοβ άνθη. Παραγόταν φυτά μοβ με ποσοστό 50% και φυτά λευκά κατά 50%. Ενώ από την διασταύρωση φυτών με βαθύ μοβ χρώμα και φυσιολογικών μοβ πήραμε 50% φυσιολογικά και 50% διαγονιδιακά μοβ.

Σημείωση: θεωρούμε ότι κάθε κύτταρο λαμβάνει από ένα πλασμίδιο Τi.

α. Περιγράψτε την διαδικασία με την οποία οι επιστήμονες δημιούργησαν διαγονιδιακά φυτά πετούνιας ξεκινώντας από την δημιουργία cDNA βιβλιοθήκης. (μονάδες 10)

β. Για ποιο λόγο το δίκλωνο ετερόλογο γονίδιο τέθηκε υπό τον έλεγχο του υποκινητή 35S του ιού της μωσαϊκώσης της πετούνιας όταν ενθέθηκε στο Ti πλασμίδιο, για ποιο λόγο δεν επιλέχθηκε ο υποκινητής του γονιδίου της χαλκόνης; (μονάδες 5)

γ. Δώστε την ερμηνεία για την μη αναμενόμενη εμφάνιση φαινοτύπων στα διαγονιδιακά φυτά. (μονάδες 10)

Ζήτημα 4.                                                                                                                Μονάδες 25

Δίνεται το παρακάτω γενεαλογικό δένδρο το οποίο αφορά την κληρονόμηση δυο ασθενειών στον άνθρωπο. Την ασθένεια του υποφυσιακού νανισμού και την συνδυασμένη εγκεφαλομυοπάθεια.

2017 Προσομοίωση-02

Προκείμενου να βρεθεί ο τρόπος κληρονόμησης της συνδυασμένης εγκεφαλομυοπάθειας πάρθηκε μυϊκός ιστός από το άτομο ΙΙΙ6, στον οποίο πραγματοποιήθηκε βιοψία και μοριακές αναλύσεις. Γνωρίζουμε ότι σύμφωνα με τις βιοψίες η ασθένεια της μυοπάθειας δεν εμφανίζει κανένα από τα γνωστά πρότυπα, ωστόσο, εμφανίζει τροποποιημένα μιτοχόνδρια, έτσι έγινε PCR ενίσχυση και πέψη με περιοριστικές ενδονουκλεάσες για τα γονίδια ND1 και ND6 του mtDNA.

Το φυσιολογικό ND1 γονίδιο δεν πέπτεται από την EcoRI, ενώ το παθολογικό αλληλόμορφο πέπτεται σε ένα σημείο. Η ίδια περιοριστική ενδονουκλεάση πέπτει το φυσιολογικό ανθρωπινό mtDNA σε ένα ακόμη σημείο.

Το φυσιολογικό αλληλόμορφο ND6 του mtDNA, πέπτεται από την PstI, ενώ το παθολογικό αλληλόμορφο όχι.

Στο ακόλουθο σχήμα δίνεται ο χάρτης περιορισμού του ανθρώπινου mtDNA, το οποίο έχει μέγεθος 17.000 ζ.β.

Δίνεται η θέση αναγνώρισης της PstI:

5’ CTGCAG3’

3’ GACGTC5’

2017 Προσομοίωση-03

Πάρθηκαν δείγματα από τα εξής άτομα της γενεαλογίας :

Ι1, Ι2, ΙΙ1, ΙΙ3, ΙΙ5, ΙΙΙ5, ΙΙΙ6, ΙΙΙ7

To mtDNA, κάθε ατόμου πέπτεται με EcoRI και PstI, ταυτόχρονα και πήραμε τα ακόλουθα αποτελέσματα. Το κυκλικό μόριο δεν εμφανίζεται.

2017 Προσομοίωση-04

Από περαιτέρω γενετικές μελέτες που έγιναν αποκλείστηκε οποιαδήποτε σχέση αυτόσωμικών γονιδίων με την μυοπάθεια.

α.Με ποιο τρόπο κληρονομείται η ασθένεια του υποφυσιακού νανισμού σύμφωνα με το γενεαλογικό δένδρο ποια διασταύρωση αποδεικνύει αυτόν τον τρόπο κληρονόμησης;      ( μονάδες 2)

β. προτείνεται ένα τρόπο κληρονόμησης ή εμφάνισης της μυοπάθειας στο άτομο που εμφανίζει τη νόσο (μονάδες 8). Με ποια πιθανότητα ένα επόμενο παιδί των ΙΙ5 και ΙΙ6 θα νοσεί (μονάδες 2);

γ. Σχεδιάστε τον περιοριστικό χάρτη του mtDNA του ατόμου Ι1 και του ατόμου Ι2 (μονάδες 3).

δ.Εξηγήστε ποια είναι η κωδική και η μη κωδική αλυσίδα των γονιδίων ND1 και ND6. Να προσδιοριστεί ο προσανατολισμός των κλώνων των δυο γονιδίων (μονάδες 6).

2017 Προσομοίωση-05

ε.Τι είδους μετάλλαξη φέρει το παθολογικό γονίδιο ND1 (μονάδες 1).

στ. Προσδιορίστε τον προσανατολισμό του μορίου mtDNA του ανθρώπου στο σημείο Α (εκατέρωθεν αυτού) (μονάδες 1).

ζ.Οι ασθένειες που μελετώνται έχουν τις προϋποθέσεις για την θεραπεία τους μέσω γονιδιακής θεραπείας (μονάδες 2);

Advertisements

Διαγώνισμα Προσομοίωσης 2016 Βιολογία Θετικού προσανατολισμού

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                   Μονάδες 25

Α1. Οι μονοκύτταροι οργανισμοί:

  1. είναι μόνο τα βακτήρια
  2. είναι δυνατόν να εμφανίζουν διαφοροποιημένα τμήματα
  3. έχουν μόνο κυκλικό/α δίκλωνα μόρια DNA
  4. έχουν πάντα οπερόνια και πλασμίδια
  5. αποκλείεται να έχουν μεμβρανώδη οργανίδια.

   Α2. Ένα άτομο που θα έχει δεχθεί γονιδιακή θεραπεία για την δρεπανοκυτταρική αναιμία:

  1. η αναλογία HbS/HbA στα ερυθροκύτταρα του αναμένεται ότι θα είναι 2:1
  2. σε ένα πρόδρομο ερυθροκύτταρό του θα υπάρχουν 4 διαφορετικές αιμοσφαιρίνες και 5 διαφορετικά γονίδια υπομονάδων των αιμοσφαιρινών
  3. θα εμφανίζει δρεπανοκύτταρα κατά τη δοκιμασία δρεπάνωσης
  4. δεν θα εμφανίζουν όλα του τα κύτταρα τον ίδιο γονότυπο
  5. όλα τα παραπάνω είναι σωστά.

Α3. Η αναλογία φαινοτύπων στην F2 γενεά, κατά το πρότυπο διασταυρώσεων του Mendel, 6:3:2:1 προκύπτει, όταν:

  1. Έχουμε διασταύρωση μονοϋβριδισμού
  2. Έχουμε διασταύρωση διϋβριδισμού με τα επικρατή γονίδια να είναι εμβρυακά θνησιγόνα
  3. Έχουμε διασταύρωση διϋβριδισμού με τα υπολειπόμενα γονίδια να είναι εμβρυακά θνησιγόνα
  4. Έχουμε διασταύρωση διυβριδισμού με ένα επικρατές και εμβρυακό θνησιγόνο γονίδιο.
  5. Τίποτα από τα παραπάνω

  Α4.  Με βάση τις αλυσίδες που σας δίνονται, οι οποίες αποτελούν το γενετικό υλικό ενός ιού, μπορείτε να συμπεράνετε ότι η μορφή του DNA του ιού, είναι:

  1. Μονόκλωνο γραμμικό,
  2. Δίκλωνο κυκλικό
  3. Μονόκλωνο κυκλικό
  4. Δίκλωνο γραμμικό
  5. τίποτα από τα παραπάνω

Ι: 5′ GCTCCTA3′             II: 5′ GGAGCTA3′

A5.Δίνονται τα δωδέκατα ζεύγη χρωμοσωμάτων του ανθρώπου που ανήκουν σε ένα ζευγάρι:

20160413_223336

  1. Το ζευγάρι έχει φυσιολογικό καρυότυπο
  2. Ο σύζυγος φέρει αμοιβαία μετατόπιση
  3. Η σύζυγος ευθύνεται για την απόκτηση παιδιών με ετερόζυγη έλλειψη
  4. ο σύζυγος έχει πιθανόν φυσιολογικό φαινότυπο άλλα όχι και φυσιολογικό καρυότυπο.
  5. Το ζευγάρι δεν μπορεί να αποκτήσει φυσιολογικούς απογόνους

 

 

Θέμα Β                                                                                         μονάδες 25

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Η γονιδιακή θεραπεία εφαρμόστηκε για πρώτη φορά τον Σεπτέμβριο του 1990 σε ένα κορίτσι τεσσάρων ετών που έπασχε από ανεπάρκεια του ανοσοποιητικού συστήματος. Η διαδικασία που ακολουθείται για την γονιδιακή θεραπεία της παραπάνω ασθενείας είναι η εξής:

Γράψτε τα επτά βήματα που περιγράφονται στην εικόνα.                     (μονάδες 7)Ex vivo

Β2. Εξηγήστε με ποιο τρόπο τα ογκοκατασταλτικά γονίδια σχετίζονται με την καρκινογένεση.                                                                             (μονάδες 5)

Β3. Εξηγήστε ότι το pH  του θρεπτικού υλικού ανάπτυξης μιας υγρή καλλιέργειας μικροοργανισμών επηρεάζει σημαντικά την ανάπτυξη της καλλιέργειας.                                                                                                                            (μονάδες 5)

Β4. Πώς συμβάλει η κλωνοποίηση στην προστασία των ζωικών ειδών που απειλούνται με εξαφάνιση;                                                                              (μονάδες 4)

Β5. Ποιοι ήταν δυο οι στόχοι του προγράμματος του ανθρώπινου γονιδιώματος;                                                                                                               (μονάδες 4)

Θέμα Γ                                                                                              μονάδες 25

Γ1. Επαναλαμβάνετε τα κλασσικά πειράματα του F. Griffith. Διαθέτετε τρεις δοκιμαστικούς σωλήνες με άγνωστα δείγματα (Α, Β, Γ) από στελέχη του βακτηρίου D. pneumoniae και θέλετε να τα χαρακτηρίσετε.

Μολύνετε με αυτά τα δείγματα, το καθένα μόνο του, και σε συνδυασμό μεταξύ τους, ποντίκια. Κατόπιν παίρνετε αίμα από τα ποντίκια και πραγματοποιείτε στερεή καλλιέργεια.

Τα αποτελέσματα των πειραμάτων σας είναι:

Αριθμός Δείγματος Δείγμα Ποντίκι Στερεή καλλιέργεια
1 Α νεκρό Ζωντανά λεία
2 Β ζωντανό κανένα
3 Γ ζωντανό Ζωντανά αδρά
4 Α+Β νεκρό Ζωντανά λεία
5 Α+Γ νεκρό Ζωντανά λεία και αδρά
6 Β+Γ νεκρό Ζωντανά λεία και αδρά

Κάθε δείγμα (Α,Β,Γ) περιεχέι μόνο ενα τύπο βακτηριακού στελέχους, να βρείτε το στέλεχος που υπάρχει σε κάθε δείγμα. Επιλέξτε από τα παρακάτω:

  1. Ζωντανά λεία-μολυσματικά
  2. θερμοθανατωμένα λεία-μολυσματικά
  3. ζωντανά αδρά- μη μολυσματικά
  4. θερμοθανατωμένα αδρά- μη μολυσματικά (μονάδες 3)

Γ2. Δίνεται το παρακάτω μεταβολικό μονοπάτι του ανθρώπινου οργανισμού.

Διαγώνισμα 2016-01

Η Αλκαπτονουρία είναι μια μεταβολική νόσος, που οφείλεται σε ανενεργότητα του ενζύμου ΕΑΚU που εμφανίζεται στο δοθέν μεταβολικό μονοπάτι με αποτέλεσμα να μην σχηματίζεται το προϊόν Γ.

α. Έστω ένα ομόζυγο άτομο για τα παθολογικά υπολειπόμενα αλληλόμορφα που ευθύνονται για την φαινυλκετονουρία και την αλκαπτονουρία (αυτοσωμική νόσος), θα περιμένατε να εμφανίζει συμπτώματα και για τις δύο ασθένειες;                (μονάδες 2)

β. Τα γονίδια που ευθύνονται για την σύνθεση των ενζύμων ΕAKU και ΕPKU και ΕM εδράζονται σε διαφορετικά ζεύγη ομόλογων χρωμοσωμάτων. Ένα ζευγάρι που και οι δυο είναι ετερόζυγοι και για τις τρεις αυτές ασθένειες, πρόκειται να αποκτήσει το πρώτο του παιδί. Με ποια πιθανότητα αυτό το παιδί θα έχει φαινότυπο αλφικού ατόμου ή θα είναι υγιές;                                                                                                       (μονάδες 14)

Γ3. Στο τρυβλίο ανάπτυξης μιας αποικίας ενός στελέχους E. coli  έσταξε καφές. Παρατηρήθηκε κατόπιν ότι υπήρχαν κύτταρα, όπου ορισμένα μόρια tRNA με αντικωδικόνιο 5΄GUA3΄υπήρχαν σε μικρότερη  ποσότητα στα κύτταρα αυτά, όμως  υπήρχαν σε αυτά τα κύτταρα και μόρια tRNA με αντικωδικόνιο 5΄UUA3΄φορτισμενα με το ίδιο αμινοξύ, όπως εκείνα με αντικωδικόνιο 5′ GUA3′.

α. Η παρουσία των μεταλλαγμένων μορίων tRNA τι συνέπειες μπορεί να έχει για το κύτταρο;                                                                                           (μονάδες 4)

β. Ποια μπορεί να είναι η αίτια της παραγωγής αυτών των μορίων tRNA από το βακτηριακό κύτταρο; Δώστε μια πιθανή εξήγηση.                                 (μονάδες 2)

Δίνεται ο γενετικός κώδικας.

 

ΘΕΜΑ Δ                                                                                         (μονάδες 25)

 

Δ1. Μια cDNA βιβλιοθήκη, δημιουργήθηκε από ηπατικά κύτταρα ανθρώπου. Απομονώθηκε το δίκλωνο μόριο DNA από αυτήν την βιβλιοθήκη, το οποίο αντιπροσωπεύει το ώριμο mRNA και υποβλήθηκε σε πέψη με τα περιοριστικά ένζυμα:  EcoRI [E], HindIII [H], και BamHI [B].

Παρακάτω φαίνεται αυτό το μόριο και οι θέσεις αναγνώρισης των περιοριστικών ενζύμων πάνω σε αυτό (περιοριστικός χάρτης).

Από κύτταρα ήπατος του ίδιου ατόμου δημιουργήθηκε και η γονιδιωματική βιβλιοθήκη. Από αυτήν την βιβλιοθηκη (γονιδιωματική) απομονώθηκε το ιδιο γονίδιο, που έδωσε και την παραπάνω cDNA βιβλιοθήκη.

Διαγώνισμα 2016-02

α. Πολλές πρωτεΐνες μας παράγονται στο ήπαρ και δρουν σε άλλα όργανα μας. Αναφέρετε δύο ασθένειες του ανθρώπου που γνωρίζεται οι οποίες επηρεάζουν δυσμενώς  τους πνεύμονες.                                                                      (μονάδες 2)

β. Εξηγήστε για ποιο λόγο, διαφέρουν οι περιοριστικές θέσεις και το μέγεθος του ίδιου γονιδίου μεταξύ των δύο βιβλιοθηκών. Μπορούμε να συνάγουμε αν το γονίδιο, όπως απομονώθηκε απο την γονιδιωματική βιβλιοθήκη φέρει μάζι και τις ρυθμιστικές αλληλουχίες του;                                                 (μονάδες 5+3)

γ. Για μια νόσο του ανθρώπου που το γονίδιο το οποίο την ελέγχει εκφράζεται στο ήπαρ, αλλά η δράση της πρωτεΐνης που αυτό κωδικοποιεί εντοπίζεται στους πνεύμονες, επιχειρήθηκε η γονιδιακή θεραπεία και παραγωγή της φαρμακευτικής αυτής πρωτεΐνης που ευθύνεται, από διαγονιδιακα φυτά.

Ποια κύτταρα του ασθενούς πρέπει να δεχθούν την γονιδιακή θεραπεία;      (μονάδες 1)

δ. Η έκφραση της ανθρώπινης πρωτεΐνης πρέπει να γίνεται αποκλειστικά στα πράσινα μέρη του διαγονιδιακού  φυτού, τα οποία συλλέγονται εύκολα. Δίνεται το πλασμίδιο Ti  και το κλωνοποιημένο τμήμα DNA που περιεχέι το γονίδιο που μας ενδιαφέρει  από την γονιδιωματική βιβλιοθήκη.

Γονίδιο:

5΄TCCGGATCCCGGAATTCCAAGGCCT——-ATG————-TGA——CGTCGACTCCGGATCCC3′

3′ AGGCCTAGGGCCTTAAGGTTCCGGA——-TAC————-ACT——GCAGCTGAGGCCTAGGG5′

Πλασμίδιο Ti:

Διαγώνισμα 2016-03

Σημείωση: Στο γονίδιο της ανθεκτικότητας στην καναμυκινη, αντί για θεση περιορισμού EcoRI υπάρχει θεση περιορισμού  KpnI.

Υπόμνημα:

Υ1: Υποκινητής του γονιδίου της μικρής υπομονάδας της Rubisco (η μικρή υπομονάδα της Rubisco κωδικοποιείται στον πυρήνα και μεταφέρεται στους χλωροπλάστες οπού και συμμετέχει στην δομή της Rubisco).

Υ2: Υποκινητής  φυτικού αυτοσωμικού γονίδιου μεταγραφικού παράγοντα ενός γονιδίου που μετέχει στην φωτοσύνθεση.

Y3: Yποκινητής του χλωροπλαστικού γονιδίου που κωδικοποιεί για την Rubisco.

Υ4:Ισχυρός βακτηριακός υποκινητής

Tum(4): Ογκογενετικό γονίδιο του πλασμιδίου Ti

ΑΛΜ: Αλληλουχίες Λήξης της Μεταγραφής.

Περιοριστικές Ενδονουκλεάσες:

BamHI: 5′ G|GATCC3′    HindIII: 5′ A|AGCTT3′   StuI: 5′ AGG|CCT3′  SalI: 5′ G|TCGAC3′

HaeIII: 5΄GG|CC3′      AluI: 5΄AG|CT3′        KpnI: 5’GGTAC|C3′    NmaI: 5’T|CCGG3′

(Δίνεται ο ένας μόνο κλώνος κάθε δίκλωνης θέσης αναγνώρισης της κάθε περιοριστικής ενδονουκλεάσης καθώς και το σημείο που πέπτει την αλληλουχία αναγνώρισης της).

 

Ποιο γονίδιο από τα 1,2,3, 4 του πλασμιδίου Ti θα επιλεγεί για να ανασυνδυαστεί με το ανθρώπινο γονίδιο;                                                                  (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 2)

ε. Υπάρχουν δυο διαφορετικοί τρόποι ενθέσεις του ετερόλογου γονιδίου εντός του κατάλληλου γονιδίου του φορέα Ti  που δίνεται. Ποιοι είναι αυτοί;            (μονάδες 2)

στ. Ποια από τις δυο παραπάνω επιλογές θα οδηγήσει στην έκφραση του ανθρώπινου γονιδίου στα φυτικά κύτταρα;  Ποια επιλογή γονιδιου εξασφαλίζει  ότι όλα τα ανσυνδυασμενα φυτικά κύτταρα θα εκφράζουν την λειτουργική πρωτεινη;                                                     (μονάδες 1)

Αιτιολογήστε την απάντηση σας.                                                   (μονάδες 3)

ζ. Με ποιο τρόπο μπορούμε ελέγξουμε αν πράγματι έχει παραχθεί η επιθυμητή ανθρώπινη πρωτεΐνη στα φύλλα του φυτού; Απλή αναφορά των τεχνικών που θα χρησιμοποιηθούν.                                                                     (μονάδες 3)

η. Ποια από τις δυο βιβλιοθήκες του ανθρώπου θα επιλέξουν οι επιστήμονες για την παραγωγή της φαρμακευτικής πρωτεΐνης από τα φύλλα του φυτού;           (μονάδες 2)

Καλή επιτυχία

Βιολογία Θετικής Κατεύθυνσης Διαγώνισμα Προσομοίωσης 2015

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                                                                                                                                                                                                                                                   Μονάδες 25

Α1. Στα πολυπεπτιδικά μόρια το πρώτο αμινοξύ:

  1. είναι πάντα η μεθείονινη
  2. έχει πάντα το αμινικό άκρο
  3. έχει πάντα το 3′ άκρο
  4. αφαιρείται μετα-μεταφραστικά πάντα
  5. αφαιρείται μετα-μεταγραφικά πάντα.

   Α2. Το βακτήριο Lactobacillus sp. όταν αναπτύσσεται σε θρεπτικό υλικό με ιχνηθετημένο άζωτο και διαιρείται, παράγονται:

  1. δυο μόρια DNA πλήρως ιχνηθετημένα
  2. ένα μόριο DNA ιχνηθετημένο και ένα όχι, όμοια μεταξύ τους
  3. δυο κλώνοι DNA συμπληρωματικοί μεταξύ τους άλλα που ανήκουν σε διαφορετικά μόρια.
  4. βακτήρια που δεν αναπτύσσονται σε περιβάλλον με pH μικρότερο του έξι
  5. βακτήρια που το DNA τους αποτελείται από δίκλωνα τμήματα DNA ιχνηθετημένα και όχι

Α3. Σε ένα χλωροπλάστη λαμβάνουν χώρα οι διαδικασίες:

Προσομοίωση θετικής 2015-03

V. όλα τα παραπάνω

   Α4. Ένα άτομο νόσει απο μια μιτοχονδριακή ασθένεια, το άτομο αυτό μπορεί να φέρει παθολογικό/α αλληλόμορφο/α για την νόσο αυτή :

  1. Στο μιτοχονδριακό DNA του μόνο
  2. στο μιτοχονδριακό και το πυρηνικό DNA του
  3. στο γονιδίωμα του
  4. στο γενετικό υλικό του πυρήνα μόνο
  5. μπορεί να ισχύει οτιδήποτε από τα παραπάνω

A5.Δίνονται τα παρακάτω γονίδια:

Προσομοίωση θετικής 2015-01

Όπου:3X: πλήθος νουκλεοτιδίων ακέραιο πολλαπλάσιο του τρία, Α.Λ.Μ: Αλληλουχίες Λήξης της Μεταγραφής.

Η κωδική αλυσίδα κάθε γονιδίου είναι:

  1. Ι=Β, ΙΙ=Γ, ΙΙΙ=Ζ, ΙV=Θ
  2. Ι=Β, ΙΙ=Δ, ΙΙΙ=Ζ, ΙV=Η
  3. Ι=Α, ΙΙ=Γ, ΙΙΙ=Ζ, ΙV=Θ
  4. Ι=Α, ΙΙ=Δ, ΙΙΙ=Ε, ΙV=Η
  5. Ι=Β, ΙΙ=Γ, ΙΙΙ=Ε, ΙV=Θ

Θέμα Β

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1.

α. Να περιγράψετε το πείραμα με το οποίο αποδείχθηκε ποιο συστατικό αποτελεί την αίτια μετασχηματισμού των βακτηρίων.

β. Τι γνωρίζεται για το γενετικό υλικό των προκαρυωτικών οργανισμών που υπάρχει σε όλα τα βακτήρια;                                                                                                                                                                                                                                                                       (μονάδες 2 +2)

Β2.

α. Τι είναι οι φαρμακευτικές πρωτεΐνες;

β. Τι γνωρίζεται για την δομή και τον φυσιολογικό ρόλο της ινσουλίνης;

γ. Ποια βήματα ακολουθούνται για την βιοτεχνολογική παραγωγή της λειτουργικής ινσουλίνης από προκαρυωτικά κύτταρα; Σύμφωνα με όσα γνωρίζεται θα μπορούσε να εφαρμοστεί η γονιδιακή θεραπεία του διαβήτη;                                                                                                                                                                                                                                                      (μονάδες 1 +3+4)

Β3. Τα κύτταρα ενός ευκαρυωτικού πολυκύτταρου οργανισμού, αν και φέρουν το ίδιο γενετικό υλικό διαφέρουν ως προς τη μορφή και την λειτουργία. Πώς επιτυγχάνεται αυτό;                                                                                                                                                                                 (μονάδες 3)

Β4.

α. Τι είναι ο καρκίνος;

β. Ποια είναι τα γονίδια που ευθύνονται για τη νόσο;

γ. Να αναφέρετε τρεις τρόπους θεραπείας για τον καρκίνο που είναι γνωστοί (απλή αναφορά)                                                                                                                                 (μονάδες 1+3+3)

Β5. Ποια είναι η μοναδική περίπτωση όπου παρατηρείται μεταφορά γενετικού υλικού από προκαρυωτικό κύτταρο σε ευκαρυωτικό κύτταρο στη φύση;                                                                                                                                                                                           (μονάδες 3)

Θέμα Γ

Να απαντήσετε στις παρακάτω ερωτήσεις

Γ1. Το παρακάτω γενεαλογικό δένδρο παρουσιάζει την κληρονόμηση της β-θαλασσαιμίας και της δρεπανοκυτταρικής αναιμίας σε μια γενεαλογία.

Προσομοίωση θετικής 2015-02

Υπόμνημα: Το άτομο Ι2 είναι ετερόζυγο για τα παθολογικά γονίδια β* και β^ και νοσεί από ήπια μορφή β θαλασσαιμίας.

Το άτομο Ι3 έχει γονότυπο β*β’ και νοσεί από βαρύτερης μορφής αναιμία.

Το άτομο ΙΙΙ1 νοσεί από δρεπανοκυτταρική αναιμία.

Το άτομο ΙΙΙ5 είναι ετερόζυγο για την δρεπανοκυτταρική αναιμία.

Τα άτομα Ι1 και Ι4 είναι αμιγή άτομα για το φυσιολογικό γονίδιο β.

Τα αλληλόμορφα β*, β^ και β΄ φέρουν σημειακή μετάλλαξη σε θέση μακριά από την θέση του 7ο κωδικονίου του φυσιολογικού γονιδίου β.

α. Τι είδους προβλήματα δημιουργούν τα δρεπανοκύτταρα;                                                                                                                                                                                                    (μονάδες 2)

β. Να υπολογιστεί το πλήθος των πιθανών διασταυρώσεων, σε επίπεδο γονοτύπου, για το ζευγάρι IV1 – IV2 που απαιτούνται για να υπολογιστεί η πιθανότητα το ζευγάρι να αποκτήσει απόγονο που νοσεί από αιμοσφαιρινοπάθεια β.

Σημείωση: Να μην υπολογιστεί η πιθανότητα.                                                                                                                                                                                                                           (μονάδες 8)

γ. Το παραπάνω ζευγάρι πραγματοποίησε προγεννετικό έλεγχο κατά την 13η εβδομάδα της κύησης ώστε να διαπιστωθεί ο γονότυπος του εμβρύου για το γονίδιο β. Με ποιο τρόπο έγινε η λήψη των εμβρυακών κυττάρων;                                                                                                                                                                                                                                                (μονάδες 2)

δ. Ποιες διαγνωστικές τεχνικές γνωρίζεται ότι διαθέτουμε για την διάγνωση της δρεπανοκυτταρικής αναιμίας και της β-θαλασσαιμίας; Ποιες από αυτές μπορούν να εφαρμοστούν στο έμβρυο;                                                                                                                                                                                                                                                                                                                  (μονάδες 5)

ε. Η περιοριστική ενδονουκλεάση ΑlmΙΙ αναγνωρίζει την αλληλουχία στο δίκλωνο DNA:

5′ C⌈TGTGAG 3′

3′ GACACT⌋C 5′

Δίνεται και το παρακάτω τμήμα DNA που περιεχέι τα κωδικόνια που κωδικοποιούν τα εννιά πρώτα αμινοξέα της αλυσίδας βς , που περιεχέι το αμινοξύ βαλίνη αντί για το γλουταμινικό οξύ, στο έκτο αμινοξύ της πολυπεπτιδίκης αλυσίδας β.

5’…ATG GTC ACC CCT GAA GCT GTG AGA AGC CAT….

…TAC CAG TGG GGA CTT CGA CAC TCT TCG GTA….

Στο εργαστήριο προγεννετικού έλεγχου που πραγματοποιήθηκε ο διαγνωστικός έλεγχος του εμβρύου χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση ΑlmΙΙ για την πέψη των γονιδίων β του εμβρύου που ενισχύθηκαν από την PCR.

Τα αποτελέσματα του έλεγχου έδειξαν ότι κανένα από τα δύο γονίδια β του εμβρύου δεν κόπηκε από την AlmΙΙ.

Ο διαγνωστικός έλεγχος έδειξε ότι το έμβρυο μετά την γέννηση του θα νοσεί ή δεν θα νόσει από δρεπανοκυτταρική αναιμία;                                                                                                               (μονάδες 2)

Ένα χρόνο μετά την γέννηση του ατόμου V1, το μωρό εμφανίζει συμπτώματα ατόμου ομόζυγου για την δρεπανοκυτταρική αναιμία και εμφάνισε θετική δοκιμασία δρεπάνωσης ενω προσδιορίστικε και στο αίμα του υψηλό ποσοστό HbS. Η επανάληψη της μοριακής εξέτασης με την περιοριστική ενδονουκλεάση Alm ΙΙ εμφάνισε την ίδια εικόνα που εμφάνισε και ως έμβρυο. Εξηγήστε τις παρατηρήσεις.                                                                                                                                   Δίνεται ο γενετικός κώδικας.                                                                                                                                                                                                                                         (μονάδες 6)

ΘΕΜΑ Δ

Να απαντήσετε στις παρακάτω ερωτήσεις

 Δ1. Σε μια περιοχή της Αφρικής για θρησκευτικούς λόγους απαγορεύεται η κατανάλωση ζωικών προϊόντων. Η διατροφή αυτών των ατόμων είναι πολύ περιορισμένη σε Τυροσίνη και λιγότερο σε Φαινυλαλανίνη. Από την διασταύρωση υγιών γονέων για τις ασθένειες της PKU και του αλφισμού, προκύπτουν απόγονοι με αναλογία 9:4:3, όταν οι γονείς αυτοί, είναι παιδιά ομόζυγων ατόμων για τις δυο αυτές ασθένειες, που ο ένας νοσεί μόνο από PKU και ο άλλος μόνο από αλφισμό. Εξηγήστε την αναλογία 9:4:3.                                                                                                         (μονάδες 8)

Δ2.

Δίνεται το γονίδιο yf το οποίο έχει μέγεθος 3kb (3000 ζ.β.). Το γονίδιο yf βρίσκεται στο πλασμίδιο pA. Θέλουμε να ανασυνδυάσουμε το γονίδιο yf στο πλασμίδιο pB. Τα πλασμίδιο pA και pB φαίνονται παρακάτω.

mit

Γνωρίζουμε ότι το λειτουργικό γονίδιο lacΖ κωδικοποιεί για το ένζυμο β-γαλακτοσιδάση, η οποία μπορεί να διασπά το άχρωμο συστατικό του θρεπτικού υλικού Χ-gal σε μια μπλε χρωστική οπότε οι βακτηριακές αποικίες θα είναι μπλε χρώματος.

α. Ποιο περιοριστικό ένζυμο θα χρησιμοποιηθεί για τον ανασυνδυασμό του γονιδίου yf με το pΒ; Όλες οι περιοριστικές ενδονουκλεάσες που δίνονται δημιουργούν μοναδικά κολλώδη άκρα. Αιτιολογήστε την απάντησή σας.                                                                                                                               (μονάδες 2+5)

β. Εξηγήστε με ποια δύο βήματα θα διακριθούν τα μετασχηματισμένα βακτήρια με το ανασυνδυασμένο πλασμίδιο από τα υπόλοιπα.                                                                                                             (μονάδες 5)

γ. Από τις αποικίες που σχηματίστηκαν επιλέχθηκαν 10 από τις οποίες απομονώθηκαν κύτταρα. Από τα κύτταρα αυτά, απομονώθηκαν τα pB πλασμίδια και αυτά πέμφθηκαν με BamHI. Τα προϊόντα της πέψης φαίνονται από παρακάτω πήκτωμα αγοράζης.

mit 2

  1. Ποια πλασμίδια δεν έχουν ανασυνδυαστεί;
  2. Ποια πλασμίδια έχουν ανασυνδυαστεί με το yf γονίδιο;

iii. Από τα πλασμίδια που έχουν ανασυνδύαστεί ποιο μπορεί να εκφράσει το yf και να παράγει την πρόδρομη πρωτεΐνη που αυτό κωδικοποιεί;

  1. Τι θα πρέπει να συμβεί για να παραχθεί η λειτουργική πρωτεΐνη;
  2. Στους κύκλους δεξιά του σχήματος προσθέστε τα σύμβολα +/- ,για να δείξετε τι είδους ηλεκτρικό φορτίο φέρουν τα μόρια του DNA.                                                                                                               (μονάδες 5)

Διαγώνισμα Προσομοίωσης 2014 Βιολογία Θετικής Κατεύθυνσης

Θέμα Α.

Στις παρακάτω ερωτήσεις επιλέξτε την απάντηση που συμπληρώνει σωστά την πρόταση:                                                                                                                    Μονάδες 25

Α1. Γονίδια οργανωμένα σε οπερόνια μπορούμε να βρούμε στο γονιδίωμα:

  1. Του λ φάγου
  2. του αδενοϊου που θα χρησιμοποιηθεί ως φορέας για την γονιδιακή θεραπεία της κυστικής ίνωσης
  3. στον πυρήνα, στους μύκητες αρτοποιίας
  4. αποκλειστικά των προκαρυωτικών κυττάρων.

Α2. Ένα διαγονιδιακό ζώο που είναι ομόζυγο για το ανθρωπινό γονίδιο της α1 αντιθρυψίνης παράγει την ετερόλογη πρωτεΐνη στο γάλα του, εκφράζοντας και τα δυο ανθρωπινά γονίδια. Προκειμένου να εκφράζονται στο ζώο τα ανθρωπινά γονίδια, αυτά βρίσκονται υπό τον έλεγχο του ζωικού υποκινητή της καζεϊνης του γάλακτος μιας πρωτεΐνης που παράγει φυσιολογικά το ζώο.

Πόσους υποκινητές καζεΐνης του γάλακτος φέρει το διαγονιδιακό αυτό ζώο στο στάδιο της μετάφασης της μίτωσης;

  1. 2
  2. 6
  3. 8
  4. 12

Α3. Το γονίδιο που κωδικοποιεί για το μόριο tRNA με αντικωδικόνιο 5’CCA3′ έχει ως τμήμα κωδικής αλυσίδας:

  1. Υποκινητής:5΄…GCACGATGCAAGTTGATTGACAA…3′
  2. Υποκινητής:3’…CGCTACGGGCCCAGAACTTGATG…5′
  3. Υποκινητής:5’…GCAACCAATGAGATAACTTGTCTGA..3′
  4. Υποκινητής:5’…CGGACCGATGAAGTGGTAGCCTCG..3′

Α4. Ένα φυτό με όγκους στον κορμό του είναι:

  1. γενετικώς τροποποιημένο
  2. υγιές φυσιολογικό
  3. μολυσμένο από το βακτήριο του εδάφους Bacillus thurigiencies
  4. μολυσμένο από το βακτήριο Agrobacterium tumefaciens

A5.Δίνεται η παρακάτω θέση έναρξης της αντιγραφής του DNA σε ένα χρωμόσωμα και δίνεται και η αλληλουχία της περιοχής 1και 2:

Print

5’…CTGACTGACA…3′ (περιοχή 1, αλυσίδα 1)

3’…GACTGACTGT…5′ (περιοχή 2, αλυσίδα 2)

Έστω ότι ένα πρωταρχικό τμήμα δημιουργείται εντός της περιοχής 1 αυτό θα έχει αλληλουχία:

  1. 5′ GACTGACTGT3′
  2. 5′ UGUCAGUCAG3′
  3. 5′ CUGACUGACA3′
  4. 5’CTGACTGACA3′

Θέμα Β

Να απαντήσετε στις παρακάτω ερωτήσεις.

Β1. Ποιες δυνατότητες μας δίνει η κατασκευή βιβλιοθηκών; Ποιες εφαρμογές βρίσκει η μέθοδος της αλυσιδωτής αντιδράσεις πολυμεράσης;                                       (μονάδες4 +4)

Β2. Ποιος είναι ο ρόλος των μονοκλωνικών αντισωμάτων ως ανοσοδιαγνωστικά;                                                                                                                                                 (μονάδες 7)

Β3. Πώς οργανώνεται το γενετικό υλικό στα προκαρυωτικά κύτταρα; Για ποιους λόγους η μελέτη της διαδικασίας της αντιγραφής του γενετικού υλικού πραγματοποιείται στο βακτήριο E. coli ;                                                                                                         (μονάδες 4+2)

Β4. Να οριστεί η έννοια του γονιδίου.                                                                       (μονάδες 4)

Θέμα Γ

Γ1. Σε ένα πείραμα εξετάζεται η ενεργότητα του ενζύμου β-γαλακτοσιδάση. Η ενεργότητα του ενζύμου υπολογίζεται με την ικανότητα ανάπτυξης βακτηρίων E.coliσε θρεπτικό υλικό που περιεχέι X-gal και IPTG ή λακτόζη. Το X-galειναι ένα ανάλογο της λακτόζης το οποίο μετατρέπεται σε μπλε όταν μεταβολίζεται από την β-γαλακτοσιδάση όμως δεν επάγει την έκφραση του οπερονίου της λακτόζης. Το IPTG είναι ένα άλλο ανάλογο της λακτόζης που προκαλεί έκφραση του οπερονίου της αλλά δεν μεταβολίζεται από τα προϊόντα του οπερονίου της λακτόζης. Τέλος η γαλακτόζη μεταβολίζεται όπως και η γλυκόζη αλλά δεν επάγει την έκφραση του οπερονίου της λακτόζης.

Print

Μετά από τυχαία μεταλλαξιγέννεση που πραγματοποιήθηκε σε φυσιολογικό στέλεχος E. coli δημιουργήθηκε μεταλλαγμένο στέλεχος που αδυνατεί να δώσει μπλε αποικίες όπως φαίνεται παρακάτω.

Το στέλεχος έχει χάσει μόνο μια λειτουργιά είτε έχει μεταλλαχθεί το ρυθμιστικό γονίδιο του οπερονίου, είτε έχει μεταλλαχθεί ο υποκινητής αυτού, είτε έχει μεταλλαχθεί ο χείριστης του οπερονίου της λακτόζης, είτε ο υποκινητής του, είτε τέλος έχει μεταλλαχθεί το δομικό γονίδιο Ζ του οπερονίου της λακτόζης.

Στελέχη Ε.coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal + 

 

Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη+γαλακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 1 Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες Λευκές αποικίες

 

 

α. Στο παραπάνω μεταλλαγμένο στέλεχος βακτηρίου ποια από τις αναφερόμενες αλληλουχίες του γονιδιώματος του μπορεί να έχει υποστεί μετάλλαξη ώστε να εμφανίζεται ο μεταλλαγμένος φαινότυπος;                                                              μονάδες 3

β. Ένα διαφορετικά μεταλλαγμένο στέλεχος του βακτηρίου που προέκυψε από την μεταλλαξιγέννεση εμφανίζει τον παρακάτω φαινότυπο: 

Στελέχη E.. coli Στερεό Θρεπτικό μέσο ανάπτυξης
Γλυκόζη +X-gal +  Γλυκόζη +X-gal +Λακτόζη+ X-gal +Γαλακτόζη +IPTG+ X-gal +Λακτόζη
Φυσιολογικό Λευκές αποικίες Λευκές αποικίες Μπλε αποικίες Μπλε αποικίες
Μεταλλαγμένο 2 Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες Μπλε αποικίες

 

Το μεταλλαγμένο αυτό στέλεχος φέρει μετάλλαξη σε ένα μόνο συστατικό του οπερονίου της λακτόζης ή του ρυθμιστικού του γονιδίου. Ποια από αυτές τις αλληλουχίες μπορεί να έχει υποστεί μετάλλαξη για να εμφανίζεται αυτός ο φαινότυπος;                            μονάδες 3

γ. Το μεταλλαγμένο στέλεχος βακτηρίων του ερωτήματος β μετασχηματίστηκε με τα φυσιολογικά δομικά γονίδια του οπερονίου της λακτόζης και τον υποκινητή τους καθώς και με το φυσιολογικό ρυθμιστικό γονίδιο και τον υποκινητή του. Ωστόσο τα μεταλλαγμένα στελέχη εξακολουθούν να εμφανίζουν τον ίδιο φαινότυπο όπως και πριν τον μετασχηματισμό τους. Σε ποιο συμπέρασμα μπορούμε να οδηγηθούμε ως προς τον προσδιορισμό του τμήματος του γονιδιώματος που υπέστει την μετάλλαξη κατά την μεταλλαξιγέννεση; Αιτιολογήστε την απάντηση σας.                                      μονάδες 1+6 

Γ2. Το φυτό Α εμφανίζει ανθεκτικότητα στην προσβολή του από ένα είδος κάμπιας. Το ίδιο είδος κάμπιας προσβάλει και μια εμπορική ποικιλία καλαμποκιού. Στο γονιδίωμα του φυτού Α χαρτογραφήθηκε, απομονώθηκε και κλωνοποίηθηκε το αυτό το γονίδιο ανθεκτικότητας.

Οι γεωπόνοι θέλουν να δημιουργήσουν μια εμπορική ανθεκτική ποικιλία καλαμποκιού σε αυτό το είδος κάμπιας. Με δεδομένο ότι τα δυο είδη φυτών είναι συγγενικά αναμένεται να είναι δυνατή η έκφραση του ετερόλογου γονιδίου του φυτού Α στο καλαμπόκι, όταν το γονίδιο της ανθεκτικότητας στις κάμπιες ενθέτεται στο γονιδίωμα του καλαμποκιού μαζί με την ρυθμιστική αλληλουχία του.

α,Έχοντας στην διάθεση σας τους χάρτες με τις θέσεις περιορισμού του πλασμίδιο Τi και του γονιδίου ανθεκτικότητας στις κάμπιες του φυτού Α, ποιο περιοριστικό ένζυμο θα επιλέγατε για τον ανασυνδυασμό του πλασμιδίου Ti, με το συγκεκριμένο γονίδιο;                                                                                                                                              μονάδες 2

Print 

β. Πώς το πλασμίδιο Ti του βακτηρίου Agrobacterium tumefaciens επιτρέπει την δημιουργία διαγονιδιακών φυτών;                                                                               μονάδες 7

γ. Απο ποιο είδος βιβλιοθήκης θα επιλέξουμε το γονίδιο της τοξίνης του βακτηρίου Bacillus thurigiensisγια την δημιουργία φυτών καλαμποκιού Bt;                          μονάδες 3

 ΘΕΜΑ Δ

 Δ1. Από την διασταύρωση δυο εντόμων Drosophilla, που και τα δυο είχαν μακριά φτερά και κόντες κεραίες προέκυψαν οι παρακάτω απόγονοι.

Άτομα F1 Γενεάς
420 με μακριά φτερά και κόντες κεραίες
211 με μακριά φτερά και μεγάλες κεραίες
206 με κοντά φτερά και κόντες κεραίες
98 με κοντά φτερά και μεγάλες κεραίες

Θεωρώντας ότι ο φυλοκαθορισμός στα έντομα αυτά προσδιορίζεται όπως και στον άνθρωπο και με δεδομένο ότι οι δυο χαρακτήρες που εξετάζονται είναι ανεξάρτητοι, να ερμηνευθούν τα αποτελέσματα ποu προέκυψαν.                                        Μονάδες 10

Δ2. Τα γονίδια β και γ των αιμοσφαιρινών μας είναι αυτοσωμικά και εδράζονται σε διαδοχικούς γενετικούς τόπους στο ίδιο ζεύγος ομολόγων χρωμοσωμάτων.

Ένας άνδρας ετερόζυγος και για τα δυο γονίδια και η σύζυγος του επίσης ετερόζυγη και για τα δυο γονίδια έχουν ιστορικό τριών συνεχόμενων πρωίμων αποβολών στην προσπάθεια τους για να τεκνοποιήσουν.

α. Ποιοι είναι οι πιθανοί γονότυποι των συζύγων αυτών;                             Μονάδες 3

β. Πώς μπορούν να εξηγηθούν οι πρώιμες αποβολές σε αυτό το ζευγάρι                                                                                                                               Μονάδες 4

γ. Η γυναίκα κυοφορεί και βρίσκεται στην 13η εβδομάδα της κύησης. Ποια μέθοδος λήψης εμβρυακών κυττάρων για την πραγματοποίηση προγεννητικού έλεγχου μπορεί να εφαρμοστεί σε αυτό το στάδιο της κύησης;

Ποια τεχνική διάγνωσης μπορεί να εφαρμοστεί στα κύτταρα του εμβρύου που ελήφθησαν ώστε να προσδιοριστεί αν το παιδί θα νοσεί από β-θαλασσαίμια;

Με ποια πιθανότητα αυτό είναι ομόζυγο για το παθολογικό αλληλόμορφο του γονιδίου γ;                                                                                                                                Μονάδες 1+1+1

δ. Το έμβρυο διαπιστώθηκε ότι είναι υγιές και ομόζυγο για τα γονίδια β και γ της αιμοσφαιρίνης Α και F αντίστοιχα, ποια είναι η πιθανότητα το επόμενο παιδί του ζευγαριού που θα γεννηθεί να είναι και αυτό υγιές; Αιτιολογήστε την απάντηση σας.                                                                                                                                         Μονάδες 5

Καλή επιτυχία

Διαγώνισμα προσομοίωσης Βιολογία θετικής 2013

Ζήτημα 1ο Μονάδες 25

1. Η αποικία είναι:
Α. Ορατή με γυμνό οφθαλμό.
Β. Ένα σύνολο από μικροοργανισμούς που ανήκουν σε διαφορετικά είδη.
Γ. Κλώνοι μικροοργανισμών που περιέχουν διαφορετικό ετερόλογο τμήμα DNA ο καθένας.
Δ. Τίποτα από τα παραπάνω.
(Μονάδες 5)

2. Η γαλακτόζη είναι:
Α. Απαραίτητη για την επιβίωση του βακτηρίου E.coli
Β. Διασπάται από τα ένζυμα που κωδικοποιεί το οπερόνιο της λακτόζης.
Γ. Συστατικό της γλυκόζης.
Δ. Μονοσακχαρίτης.
(Μονάδες 5)

3. Στο γονίδιο της αλυσίδας β της HbS, το έβδομο κωδικόνιο είναι το:
Α. Το 5’GAG3’
Β. Το 3’GAG5’
Γ. Το 5’GTG3’
Δ. Το 3’GCG5’
(Μονάδες 5)

4. Στον καρυότυπό μας το πλήθος των γονιδίων των αιμοσφαιρινών, είναι:
Α. 12
Β. 20
Γ. 6
Δ. 10
(Μονάδες 5)

5. Η κυστεϊνη που μεταφέρεται από ένα μόριο tRNA μετά από χημική επεξεργασία μπορεί να αλλάξει σε αλανίνη. Αν κάποια από αυτά τα τροποποιημένα tRNA προστεθούν σε κυτταρικό εκχύλισμα σύνθεσης πρωτεϊνών που περιέχει όλα τα απαραίτητα στοιχεία που απαιτούνται για τη φυσιολογική μετάφραση, ποιο από τα παρακάτω είναι το πιθανότερο μετά την προσθήκη mRNA που έχει κωδικόνια τόσο κυστεϊνης, όσο και αλανίνης΄;
Α. Κυστεϊνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου αλανίνης.
Β. Η αλανίνη θα προστίθεται κάθε φορά κατά τη μετάφραση του κωδικονίου της κυστεϊνης.
Γ. Η πρωτεΐνη μπορεί να έχει λιγότερες κυστεϊνες.
Δ. Η πρωτεΐνη που θα προκύψει θα είναι φυσιολογική.
(Μονάδες 5)

Ζήτημα 2ο

1. Το 1944 πραγματοποιήθηκε ένα ιστορικό πείραμα για την Βιολογία. Σε ποια συμπεράσματα οδήγησε αυτό το πείραμα;
(Μονάδες 3)
Ποια άλλα βιοχημικά δεδομένα της εποχής υποστηρίζουν τα δεδομένα αυτού του πειράματος;
(Μονάδες 3)
2. Στο γάλα των διαγονιδιακών ζώων μπορούν να εκκρίνονται φαρμακευτικές πρωτεΐνες. Ποια γνωρίζεται ότι είναι η πιο επιτυχημένη εφαρμογή παράγωγης τέτοιων πρωτεϊνών από ζώα;
(Μονάδες 8)
3. Ποια διαδικασία ακολουθήθηκε για τη γονιδιακή θεραπεία της κυστικής ίνωσης το 1993;
(Μονάδες 6)
4. Περιγράψτε το πρότυπο των πειραμάτων του Mendel, τα αποτελέσματα των οποίων τον οδήγησαν στη διατύπωση των νόμων της κληρονομικότητας;
(Μονάδες 5)
Ζήτημα 3ο

Α. Ένα ευκαρυωτικό κύτταρο που περιέχει 0,8ng μη ραδιενεργό φωσφόρο στο μοναδικό χρωμόσωμα που διαθέτει, όταν τοποθετείται σε θρεπτικό υλικό που περιέχει κατά 50% μη ραδιενεργό φώσφορο και κατά 50% ραδιενεργό φωσφόρο, πολλαπλασιάζεται. Να βρεθούν τα ng του ραδιενεργού και του μη ραδιενεργού φωσφόρου (θεωρούμε ότι δεν υπάρχει διαφορά μάζας μεταξύ ραδιενεργού και μη ραδιενεργού φωσφόρου) που θα υπάρχουν στο γενετικό υλικό των κυττάρων που θα προκύψουν:
α. Μετά τον πρώτο διπλασιασμό του αρχικού κυττάρου.
(Μονάδες 3)
β. Μετά το δεύτερο διπλασιασμό που θα συμβεί σε αυτό το θρεπτικό υλικό.
(Μονάδες 3)

γ. Το παραπάνω πείραμα χαρακτηρίζεται ως in vivo ή ως in vitro; (Μονάδες 1)

Β. Το ρυθμιστικό γονίδιο του οπερονίου της λακτόζης στο βακτήριο E.coli έχει την παρακάτω υποθετική αλληλουχία ζευγών νουκλεοτιδίων. Ένα βακτηριακό στέλεχος έχει υποστεί μετάλλαξη στο ρυθμιστικό γονίδιο το οπερονίου της λακτόζης, με συνέπεια να παράγονται μόρια καταστολέα τα οποία συνδεονται πολύ ισχυρά με τον χειριστη.

Φυσιολογικό γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTCAGCCCGTACTTAAGAG

Μεταλλαγμένο γονίδιο:
Αλυσίδα 1: GTTGAATTCTTAGCTTAATAAGTCGGGCATGAATTCTC
Αλυσίδα 2: CAACTTAAGAATCGAATTATTCAGCCCGTACTTAAGAG

α. Εξηγείστε ποιός θα είναι ο φαινότυπος του συγκεκριμένου στελέχους σε περιβάλλον με μοναδική πηγή άνθρακα τη γλυκόζη (Μονάδες 3) και σε περιβάλλον με μοναδική πηγή άνθρακα τη λακτόζη (Μονάδες 3).

β. Εντοπίστε το είδος της μετάλλαξης που έχει συμβεί (Μονάδες 1) και εξηγείστε με ποιό τρόπο αυτή επηρεάζει το γονιδιακό προϊόν (Μονάδες 3).

γ. Οι επιστήμονες τροποποίησαν γενετικά το συγκεκριμένο βακτηριακό στέλεχος , το οποίο στερείται πλασμιδίων και περιοριστικών ενζύμων, με το φυσιολογικό ρυθμιστικό γονίδιο.
Έχοντας στη διάθεσή τους τις περιοριστικές ενδονουκλεάσες (EcoRI, TruqI, TscI)και φορείς κλωνοποίησης, εξηγήστε ποια περιοριστική ενδονουκλεάση και ποιος φορέας κλωνοποίησης θα επιλεγεί για τον μετασχηματισμό.
(Μονάδες 1)
Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
Διαγώνισμα 2

δ. Το μετασχηματισμένο βακτηριακό στέλεχος αναπτύχθηκε σε θρεπτικό υλικό με μοναδική πηγή άνθρακα τη λακτόζη, μαζί με το φυσιολογικό στέλεχος του βακτηρίου, πώς θα γίνει δυνατή η διάκριση των δύο στελεχών;
Το φυσιολογικό στέλεχος στερείται πλασμιδίων.
(Μονάδες 4)

Ζήτημα 4ο

Το παρακάτω γενεαλογικό δένδρο αφορά την ασθένεια της οικογενούς υπερχοληστερολαιμίας
Διαγώνισμα 1

α. Με ποιό τύπο κληρονομικότητας γνωρίζεται ότι κληρονομείται η παρακάτω νόσος;
(Μονάδες 1)
Ποια διασταύρωση του δένδρου αποδεικνύει αυτόν τον τύπο κληρονομικότητας και ποια τον αποκλείει (Μονάδες 2); Αιτιολογήστε την απάντησή σας.
(Μονάδες 3)
β. Το ζευγάρι ΙΙΙ1 και ΙΙΙ2 ζήτησε γενετική καθοδήγηση σχετικά με το αν πρόκειται να αποκτήσουν απόγονο με οικογενή υπερχοληστερολαιμία.
Τι είναι η γενετική καθοδήγηση;
(Μονάδες 3)
Ποιες είναι οι προϋποθέσεις που πρέπει να διαθέτει ο ειδικός επιστήμονας ώστε να συμβουλέψει τους ενδιαφερόμενους;
(Μονάδες 3)
Ποια ήταν η απάντηση του ειδικού επιστήμονα στο ζευγάρι;
(Μονάδες 1)
γ. Το παιδί IV1 γεννήθηκε και νοσεί από οικογενή υπερχοληστεριναιμία. Από τις διαγνωστικές εξετάσεις που έγιναν διαπιστώθηκε ότι οι γονείς έχουν φυσιολογικό καρυότυπο και το παιδί έχει φυσιολογικό αριθμό χρωμοσωμάτων, αλλά φέρει το ένα από τα δύο αντίγραφα του γονιδίου που ελέγχει για την ασθένεια, μαζί με γειτονικούς του γενετικούς τόπους, σε διαφορετικά χρωμοσώματα από το χρωμόσωμα που φέρεται φυσιολογικά ο γενετικός τόπος του γονιδίου.
Τι είδους μετάλλαξη φέρει το παιδί;
(Μονάδες 2)
Πώς εξηγείται η γέννηση του παιδιού IV1 το οποίο εκφράζει το παθολογικό επικρατές αλληλόμορφο για την νόσο, από υγιείς γονείς, δηλαδή ομόζυγους για το υπολειπόμενο φυσιολογικό αλληλόμορφο για την ασθένεια, αποκλείοντας την γονιδιακή μετάλλαξη;
(Μονάδες 10)

Διαγώνισμα προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2012

Ζήτημα 1ο
Μονάδες 25
Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω προτάσεις 1-5 και δίπλα το γράμμα που αντιστοιχεί στην λέξη ή φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Επίσης να απαντήσετε σύντομα στις ερωτήσεις που ακολουθούν.
1. Οι «λείες» αποικίες των βακτηρίων στο πείραμα του Griffith το 1928, ξεχωρίζουν μορφολογικά από τις αποικίες του στελέχους που σχημάτιζε «αδρές» αποικίες
α. λόγω της ιδιότητάς τους να σκοτώνουν τα ποντίκια.
β. λόγω της παρουσίας ενός προστατευτικού καλύματος στα βακτήρια των λείων αποικιών.
γ. διότι οι αποικίες είναι ορατές με γυμνό οφθαλμό.
δ. όλα τα παραπάνω.
Μονάδες 2
Τι ορίζουμε ως αποικία;
Μονάδες 3
2. Κατά την επιμήκυνση της πρωτεϊνοσύνθεσης:
α. δημιουργείται το σύμπλοκο mRNA-μικρή υπομονάδα ριβοσώματος-tRNAmet.
β. σχηματίζεται ο πρώτος πεπτιδικός δεσμός του συγκεκριμένου μορίου της πεπτιδικής αλυσίδας.
γ. το tRNA κινείται κατά ένα κωδικόνιο κατά μήκος του mRNA.
δ. το mRNA μετακινείται κατά ένα κωδικόνιο κάθε φορά.
Μονάδες 2
Τι ορίζουμε ως κωδικόνιο, ποια μόρια νουκλεϊκών οξέων αφορά;
Μονάδες 3
3. Η ανάπτυξη της τεχνολογίας του ανασυνδυασμένου DNA έγινε εφικτή, λόγω
α. της απομόνωσης των περιοριστικών ενδονουκλεασών καθώς και ειδικών φορέων που μεταφέρουν DNA από κύτταρο σε κύτταρο.
β. της ανάπτυξης της Γενετικής Μηχανικής και της ανάπτυξης των μορίων ανιχνευτών.
γ. της απομόνωσης και χρήσης ενζύμων που παρέχουν την δυνατότητα της in vitro «αναπαραγωγής» των διαδικασιών αντιγραφής, αντίστροφης μεταγραφής και μετάφρασης.
δ. λόγω των επιλογών α και γ.
Μονάδες 2
Πότε ένα μόριο DNA είναι ανασυνδυασμένο; Πώς γίνεται δυνατή η αναπαραγωγή και η διαιώνιση αυτού του μορίου DNA;
Μονάδες 3
4. Η φαινοτυπική αναλογία 3 : 1
α. εμφανίζεται πάντοτε στην F2 γενεά κατά τις διασταυρώσεις μονοϋβριδισμού.
β. εμφανίζεται μόνο κατά τις διασταυρώσεις μονοϋβριδισμού μεταξύ ετερόζυγων ατόμων με το ίδιο ζεύγος αλληλόμορφων για κάθε άτομο.
γ. είναι δυνατό να εμφανίζεται τόσο κατά της διασταυρώσεις μονοϋβριδισμού όσο και κατά τις διασταυρώσεις διϋβριδισμού.
δ. εμφανίζεται πάντα κατά τις διασταυρώσεις μεταξύ ετερόζυγων ατόμων σε διασταυρώσεις μονοϋβρισισμού.
Μονάδες 2
Τι πληροφορίες μας προσφέρουν τα γενεαλογικά δένδρα;
Μονάδες 3
5. Ποια από τα παρακάτω δεν είναι μεταλλαξογόνοι παράγοντες στο σύνολό τους;
α. Οι ακτινοβολίες γ, α, Χ και η ηλιακή ακτινοβολία.
β. Η φορμαλδεΰδη, το βενζοπυρένιο (κυκλικός αρωματικός υδρογονάνθρακας).
γ. Η φαινυλαλανίνη, οι πουρίνες και ΑΑΤ.
δ. Η πενικιλλίνη, η καφεΐνη και η αιθυλική αλκοόλη. Μονάδες 2
Τι είναι ο καρκίνος; Ποιες κατηγορίες γονιδίων ευθύνονται για τον καρκίνο;
Μονάδες 3
Ζήτημα 2ο
Μονάδες 25
Να απαντήσετε στις παρακάτω ερωτήσεις.
1. Οι αρχικές μελέτες της ρύθμισης των γονιδίων έγιναν το 1961 από τους γάλλους επιστήμονες Jacob και Monod. Με τις μελέτες αυτές ανακαλύφθηκε ο τρόπος με τον οποίο το βακτήριο E.coli λύνει το πρόβλημα της τροφοδότησής του με άνθρακα και ενέργεια όταν αναπτύσσεται σε περιβάλλον με μοναδικό υδατάνθρακα την λακτόζη. Τι απέδειξαν οι ερευνητές για τη λειτουργία του βακτηρίου E.coli σε τέτοιο περιβάλλον;
Μονάδες 5
2. Το 1953 περιγράφηκε η δευτεροταγής δομή του DNA στους οργανισμούς. Περιγράψτε τα χαρακτηριστικά αυτής της δομής. Μονάδες 5
3. Ποια είναι τα απαραίτητα βήματα για την εργαστηριακή καλλιέργεια των μικροοργανισμών; Μονάδες 5
4. Το 1997 έγινε δυνατή η κλωνοποίηση ενός εξάχρονου πρόβατου. Περιγράψτε τα βήματα που ακολουθήθηκαν και αναφέρεται ποιες μπορεί να είναι οι προοπτικές της κλωνοποίησης.
Μονάδες 5
5. Ποιες δυνατότητες προσφέρει η αλληλουχία του ανθρώπινου γονιδιώματος στους τομείς της μελέτης της οργάνωσης και λειτουργίας του και στην ανάπτυξη μεθοδολογίας για τη διάγνωση και τη θεραπεία των ασθενειών.
Μονάδες 5
Ζήτημα 3ο
Μονάδες 25
Στο παρακάτω γενεαλογικό δένδρο μελετάται η ασθένεια του αλφισμού.


α. Να βρεθούν οι δυνατοί γονότυποι όλων των ατόμων της γενεαλογίας.
Μονάδες 8
β. Το ζευγάρι IV1 και IV2 πρόκειται να αποκτήσουν και τέταρτο παιδί. Με ποια πιθανότητα αυτό θα είναι αγόρι με φαινότυπο με πολύ ήπια συμπτώματα ή θα είναι κορίτσι που θα νοσεί από αλφισμό με φαινότυπο όμοιο με αυτό της δεύτερης αδελφής του;
Μονάδες 8
γ. Τι γνωρίζεται για την ασθένεια του αλφισμού; Τι σημαίνει ετερογένεια σε φαινοτυπικό επίπεδο και πώς ερμηνεύεται σε γονοτυπικό επίπεδο;
Μονάδες 9
Ζήτημα 4ο
Μονάδες 25
Οι παρακάτω αλληλουχίες DNA αφορούν τον γενετικό τόπο του γονιδίου που ελέγχει για την ασθένεια του αλφισμού. Η πρώτη αλληλουχία συνιστά το φυσιολογικό επικρατές αλληλόμορφο του γονιδίου.
α. Να εντοπίσετε την μετάλλαξη που έχει συμβεί σε καθένα από τα παθολογικά αλληλόμορφα που σας δίνονται.
Μονάδες 4
β. Να υποδείξετε, σύμφωνα με τη μετάλλαξη που φέρει κάθε αλληλόμορφο, ποιο αναμένεται να ευθύνεται:
Μονάδες 4
i. για την παντελή έλλειψη ενεργότητας του ενζύμου.
ii. για την πολύ περιορισμένη ενεργότητα του ενζύμου.
iii. για περιορισμένη ενεργότητα του ενζύμου.
iv. για τη μικρή αλλαγή στην στερεοδιάταξη του ενζύμου.
γ. Ποια είναι υποθετικά η φυσιολογική πρωτοταγή δομή του ενζύμου στο τμήμα που σας δίνεται;
Μονάδες 4
δ. Οι επιστήμονες ενδιαφέρονται να αναπτύξουν γονιδιακή θεραπεία για τον αλφισμό.
i. Ποιες είναι οι απαραίτητες προϋποθέσεις για την εφαρμογή της γονιδιακής θεραπείας;
Μονάδες 7
ii. Ποια μέθοδο θα πρέπει να ακολουθήσουν ex vivo ή in vivo; Να αιτιολογήσετε την απάντησή σας.
Μονάδες 6
(Μεταξύ των σημείων Χ και Υ περιέχονται τα κωδικόνια που κωδικοποιούν για τα αμινοξέα του ενεργού κέντρου του ενζύμου.)

Print
Δίνονται τα κωδικόνια:

ATG -> Met

AAA -> Lys

TTT -> Phe

GAG -> Glu

CCC -> Pro

GAA -> Glu

TCA -> Ser

AGA -> Arg

TCC -> Ser

TTG -> Leu

Καλή Επιτυχία!