Category Archives: Διαγωνίσματα Κατεύθυνσης

Διαγώνισμα βιολογίας θετικού προσανατολισμού στα κεφαλαία 2-4

ΖΗΤΗΜΑ 1Ο                                                                                             ΜΟΝΑΔΕΣ 25

 

Α)                                                                                                             ΜΟΝΑΔΕΣ 15

  1. Ποιο από τα παρακάτω πλασμίδια είναι κατάλληλο να χρησιμοποιηθεί ως φορέας κλωνοποίησης σε ζυμομύκητα cDNA βιβλιοθήκης του αλόγου;

2017 Διαγώνι??? 2-4-01

Υπόμνημα: όπου Υ = Υποκινητής, ΑΛΜ= Αλληλουχίες Λήξης της Μεταγραφής,

ΘΕΑ= Θέση Έναρξης της Αντιγραφής, TetR = γονίδιο ανθεκτικότητας στο αντιβιοτικό τετρακυκλινη, Killer= γονίδιο που κωδικοποιεί για μια τοξική πρωτεΐνη για τον ξενιστή, lacZ  = γονίδιο που κωδικοποιεί για την β-γαλακτοζιδαση, Polylinker= πολλές διαφορετικές μοναδικές διαδοχικές αλληλεπικαλυπτόμενες θέσεις περιορισμού. Κάθε polylinker εδώ είναι διαφορετικός από τους άλλους.

1ο πλασμιδιο: οι υποκινητές είναι οι φυσικοί υποκινητές των αναφερομένων γονίδιων.

2ο πλασμιδιο: ο πρώτος υποκινητής είναι γονίδιου της ζύμης, ο δεύτερος υποκινητής είναι ο φυσικός υποκινητής του γονίδιου lacZ.

3o  πλασμιδιο: όλοι οι υποκινητές και οι ΑΛΜ ανήκουν στη ζύμη.

4ο πλασμιδιο: οι ΑΛΜ στα δεξιά ανήκουν στο γονίδιο της ανθεκτικότητας στην τετρακυκλινη.

  1. Πόσα γονίδια υπάρχουν στο παρακάτω τμήμα γονιδιωματικής βιβλιοθήκης του βακτηρίου Treponema Pallidum. Ορίστε τα τμήματα που τα αποτελούν.

2017 Διαγώνι??? 2-4-02

Ο Υποκινητής δεξιά είναι ο Υ1 και βρίσκεται στην περιοχή Β του χρωμοσώματος

Τ και Ρ Συντηρημένες αλληλουχίες

 

α) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Ε + Δ + Γ + Β + Α + Ω)

β) Δύο γονίδια: γονίδια: (Υ1 : Γ + Δ, Υ2 : Η + Θ)

γ) Δύο γονίδια: γονίδια: (Υ1 : Β + Α + Ω, Υ2 : Ζ + Ε + Δ)

δ) Δύο γονίδια: γονίδια: (Υ2 : Η + Θ, Υ1 : Α + Ω)

  1. Ο ρυθμός της κυτταρικής διαφοροποίησης στο σύνολο του οργανισμού από την εμβρυική ηλικία μέχρι τα βαθιά γεράματα θα μπορούσε να αποδοθεί με το γράφημα:

2017 Διαγώνι??? 2-4-03

Σημείωση: Τα διαγράμματα δεν δίνονται υπό κλίμακα.

  1. Η αντιγραφή ενός κυκλικού μορίου DNA μπορεί να γίνεται σύμφωνα με ότι γνωρίζετε από το σχολικό βιβλίο.

2017 Διαγώνι??? 2-4-04

ε) Με όλους τους παραπάνω τρόπους.

στ) Με τους δύο πρώτους αναλόγως το είδος του κυκλικού μορίου.

  1. Δίνονται τα παρακάτω δύο γραμμικά μόρια DNA:

2017 Διαγώνι??? 2-4-05

Τα μόρια DNA πέπτονται από δύο διαφορετικές Π.Ε την EcoRI και ένα περιοριστικό ένζυμο που αναγνωρίζει την αλληλουχία     5΄ C TTAAG

                                                                                                GAATT C

και κόβει μεταξύ του C και Τ σε κάθε κλώνο.

Εν συνεχεία τα δύο αυτά κομμένα μόρια αναμειγνύονται παρουσία του ενζύμου DNA δεσμάση. Μπορούν να δημιουργηθούν οι συνδυασμοί:

α) Α1 + Α3, Β1 + Β3, Α2 + Β2

β) Α1 + Β3, Β1 + Α3, Α2 + Β2

γ) Α1 + Β1, Α3 + Β3, Α2 + Β2

δ) Α1 + Α3, Β1 + Β3

Β) Χαρακτηρίστε ως Σ ή Λ καθεμία από τις παρακάτω προτάσεις:

ΜΟΝΑΔΕΣ 10

  1. Σε ένα βακτήριο έχει συμβεί λάθος κατά την αντιγραφή του DNA του (κυρίως μόριο), το οποίο δεν επιδιορθώθηκε στη ΘΕΑ και δεν αναγνωρίζεται από τις DNA ελικάσες, η μετάλλαξη αυτή είναι θνησιγόνος.
  2. Σε ένα ευκαρυωτικό χρωμόσωμα έγινε το ίδιο λάθος, όπως παραπάνω, σε ένα σημείο του χρωμοσώματος, είναι η μετάλλαξη αυτή θανατηφόρα;
  3. Τα ευκαρυωτικά χρωμοσώματα σε κάθε μίτωση είναι πιο κοντά από τα αντίστοιχα της προηγούμενης μίτωσης στην ίδια κυτταρική σειρά, αυτό συμβαίνει και με το βακτηριακό DNA.
  4. Στο διπλανό σχήμα για την ενίσχυση του τμήματος Α με PCR τα κατάλληλα τεχνητά ολιγονουκλεοτίδια είναι το ζευγάρι 1-3.

2017 Διαγώνι??? 2-4-06

5. Εάν ένα ευκαρυωτικό γονίδιο έχει 4 εσώνια, από το γονίδιο αυτό προκύπτουν έως 8 διαφορετικά ώριμα mRNA.

 

 

ΖΗΤΗΜΑ 2ο                                                                                             ΜΟΝΑΔΕΣ 25

1) Σε μία άσκηση ενός πανεπιστημιακού εργαστηρίου Μοριακής Βιολογίας μία ομάδα φοιτητών προσπαθεί να δημιουργήσει τη γονιδιωματική βιβλιοθήκη του βακτηρίου Lactobacillus sp.

Οι φοιτητές διαθέτουν ένα φορέα κλωνοποίησης πλασμίδιο που φέρει γονίδια ανθεκτικότητας στα αντιβιοτικά Στρεπτομυκίνη (StrR) και Αμπικιλλίνη (AmpR). Το τελευταίο φέρει και τη μοναδική θέση ανασυνδυασμού. Τα βακτήρια-ξενιστές είναι ένα κατάλληλο στέλεχος E.coli.

Στην εργασία τους οι φοιτητές έγραψαν:

«Μετά τον ανασυνδυασμό των φορέων κλωνοποίησης από τα θραύσματα του DNA του Lactobacillus sp. επακολούθησε ο μετασχηματισμός των βακτηρίων-ξενιστών. Μετά τον μετασχηματισμό, υπήρχαν 3 κατηγορίες βακτηρίων E.coli.

α) Τα μη μετασχηματισμένα που δεν φέρουν ανθεκτικότητα ούτε σε Str, ούτε σε Amp.

β) Τα μετασχηματισμένα

  1. Με το μη ανασυνδυασμένο φορέα κλωνοποίησης που έχουν ανθεκτικότητα και στα δύο αντιβιοτικά.
  2. Με τον ανασυνδυασμένο φορέα κλωνοποίησης που φέρουν ανθεκτικότητα μόνο στο αντιβιοτικό Str.

Ο διαχωρισμός των βακτηρίων που αποτελούν τη βιβλιοθήκη από τα υπόλοιπα κύτταρα E.coli θα γίνει ως εξής:

Τα ζητούμενα βακτήρια  E.coli είναι τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.

Στην την υγρή βακτηριακή καλλιέργεια των ξενιστών που χρησιμοποιήθηκαν για το μετασχηματισμό τους, υπήρχε το αντιβιοτικό Str, οπότε τα μόνα βακτήρια που επέζησαν ήταν τα μετασχηματισμένα. Από αυτή την υγρή καλλιέργεια επιλέγουμε κάποια βακτήρια και τα καλλιεργούμε μεμονωμένα σε υγρό θρεπτικό υλικό. Στη συνέχεια χωρίζουμε τους απογόνους σε δύο ίσα μέρη και σε κάποια βακτήρια από τα δύο αυτά μέρη χορηγούμε αμπικιλλίνη. Αν πεθάνουν κάποια, συμπεραίνουμε ότι προέρχονται από την ομάδα που μας ενδιαφέρει, δηλαδή τα μετασχηματισμένα με το ανασυνδυασμένο πλασμίδιο.»

Εξηγήστε γιατί οι φοιτητές μηδενίστηκαν από τον υπεύθυνο του εργαστηρίου.

μονάδες 5

2) Εργάζεστε σε μία φαρμακευτική βιομηχανία και ενδιαφέρεστε να δημιουργήσετε  το εμβόλιο κατά ενός νέου ιού. Ξεκινάτε ψάχνοντας στο γονιδίωμα του ιού, ώστε να βρείτε τα/το γονίδιο που κωδικοποιεί για μία κατάλληλη πρωτεΐνη αντιγονικό καθοριστή του ιού.

Εξηγήστε του είδους βιβλιοθήκη του ιικού DNA θα δημιουργήσετε, γονιδιωματική ή cDNA;

3) Δίνεται το παρακάτω μόριο RNA προϊόν της μεταγραφής ενός βακτηρίου. Το μόριο αυτό είναι λειτουργικό.

2017 Διαγώνι??? 2-4-07

α) Τι είδους γονίδιο το κωδικοποιεί αυτό το μόριο RNA; (3)

β) Γράψτε το τμήμα του γονιδίου που το κωδικοποιεί και αφορά την περιοχή 3. Προσδιορίστε την κωδική αλυσίδα του γονιδίου και τον προσανατολισμό των κλώνων του. (4)

γ) Τι είδους δεσμοί σταθεροποιούν αυτή τη δομή του μορίου RNA εντός της περιοχής 2; Ποιο ένζυμο καταλύει τη δημιουργία αυτών των δεσμών; (2)

δ) Στην περιοχή 1 δίνεται ένα τμήμα της αλληλουχίας της. Μπορούμε να υπολογίσουμε τα % των βάσεων %Α, %U, %C και %G στην απέναντι πλευρά της περιοχής 1 από αυτήν που δίνεται η ακολουθία; (3)

ε) Απαντήστε στο ίδιο ερώτημα αν η ακολουθία αυτή της περιοχής 1 ήταν εντός της περιοχής 2. (3)

ΖΗΤΗΜΑ 3Ο                                                                                             ΜΟΝΑΔΕΣ 25

Α) Παρακάτω δίνονται τα τμήματα δύο διαφορετικών γονιδίων. Το γονίδιο 1 κωδικοποιεί για μία πρωτεΐνη που εκφράζεται πάντα σε υψηλό ρυθμό. Το γονίδιο 2 εκφράζεται μόνο σε ένα κατάλληλο αναπτυξιακό στάδιο του οργανισμού.

Συνέβη αναδιάταξη γονιδίων και το τμήμα του γονιδίου 2 που δίνεται τοποθετήθηκε κοντά στον υποκινητή του γονιδίου 1. Δημιουργήθηκαν 4 διαφορετικές αναδιατάξεις. Εξηγήστε σε ποια από όλες εκφράστηκε το τμήμα του γονιδίου ② και για ποιο λόγο δεν εκφράστηκε σωστά ή καθόλου στις άλλες πιθανές αναδιατάξεις.

Σημείωση: Η αλληλουχία που δίνεται Italics και υπογραμμισμένη αποτελεί τον υποκινητή. Τα νούμερα δηλώνουν το πλήθος των νουκλεοτιδίων.  Στο γονίδιο ② η υπογράμμιση δηλώνει το πλαίσιο ανάγνωσης του γονιδίου. Στο γονίδιο ① τα bold ζεύγη βάσεων δηλώνουν τις 4 πιθανές θέσεις αναδιάταξης του γονιδίου ②. Το τμήμα του γονιδίου ② τοποθετείται κάθε φορά αμέσως μετά τη θέση 83, 136, 155, 183 του γονιδίου ①.

gene

Β) Το φυσιολογικό γονίδιο ① αντιγράφεται. Από τη θέση 80 έως τη θέση 140 υπάρχει θέση έναρξης της αντιγραφής.

Δίνονται τα παρακάτω πρωταρχικά τμήματα:

  1. 5΄ AGAGAGAGAA 3΄
  2. 5΄ CUCCCCCGCG 3΄
  3. 5΄ AUAUAAUCUA 3΄
  4. 5΄ CCAUACAUAG 3΄

τα οποία είναι τα πρώτα πρωταρχικά τμήματα που τοποθετούνται από τα πριμοσώματα. Γνωρίζετε ότι το πριμόσωμα τοποθετεί πρωταρχικό τμήμα 10 νουκλεοτιδίων κάθε 30 νουκλεοτίδια από το 5΄ άκρο του ακριβώς προηγούμενου πρωταρχικού τμήματος.

  • Να βρεθούν τα δύο επόμενα πρωταρχικά τμήματα που θα τοποθετήσουν τα πριμοσώματα. (10)
  • Σε ποιο κλώνο, στον πάνω ή στον κάτω, κινείται η DNA πολυμεράση χρησιμοποιώντας τον ως καλούπι που τοποθέτησε το 29ο νουκλεοτίδιο στον κλώνο που συντίθεται ασυνεχώς και το νουκλεοτίδιο αυτό ήταν η Τ. (3)

ΖΗΤΗΜΑ 4Ο

 Σε δύο διαφορετικά βακτηριακά στελέχη E.coli μελετήθηκε η κινητική της παραγωγής της β-γαλακτοσιδάσης, παρουσία και απουσία λακτόζης. Όταν δεν υπήρχε λακτόζη, τα βακτήρια αναπτύσσονταν σε γαλακτόζη.

2017 Διαγώνι??? 2-4-08

Για την ερμηνεία της καμπύλης ① δημιουργήθηκαν οι γονιδιωματικές βιβλιοθήκες των δύο στελεχών. Σε κάθε περίπτωση χρησιμοποιήθηκαν οι ίδιες περιοριστικές ενδονουκλεάσες και για τα δύο στελέχη. Η χρήση αυτών των Π.Ε. επιτρέπει την κοπή του γονιδιώματος του E.coli με τέτοιο τρόπο ώστε να δημιουργείται θραύσμα με ακέραιο το τμήμα που περιλαμβάνει από τον υποκινητή του ρυθμιστικού γονιδίου μέχρι και τις αλληλουχίες λήξης της μεταγραφής των δομικών γονιδίων.

Από τη σύγκριση των αλληλουχιών των οπερονίων των δύο στελεχών δεν παρατηρήθηκε καμία διαφορά μεταξύ τους.

Η σύγκριση έγινε με πέψη με ορισμένο πλήθος και είδος περιοριστικών ενδονουκλεάσεων που πέπτουν εντός του απομονωμένου τμήματος.

2017 Διαγώνι??? 2-4-10

Το Gel αφορά τη γονιδιωματική βιβλιοθήκη  για τους κλώνους που περιέχουν το οπερόνιο στις  βιβλιοθήκες Α και Β.

Κάθε  μια από τις πέψεις i, ii, ii  έγινε με διαφορετικό σύνολο περιοριστικών ενζύμων.

Ακολούθησε PCR μέθοδος στα γονιδιώματα των στελεχών:

  1. PCR για την ενίσχυση του γονιδίου της β-γαλακτοσιδάσης.
  2. PCR για την ενίσχυση του χειριστή.
  3. PCR για την ενίσχυση του ρυθμιστικού γονιδίου.

Κατόπιν επακολούθησε πέψη των προϊόντων της PCR για τη σύγκριση των αλληλουχιών αυτών των δύο στελεχών.

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα του PCR είναι: Για την ενίσχυση των περιοχών DNA:

2017 Διαγώνι??? 2-4-11

iii

2017 Διαγώνι??? 2-4-09

Ακόμη είχε γίνει υβριδοποίηση των γονιδιωματικών βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των αποικιών των παραπάνω περιοχών του οπερονίου.

Τα αποτελέσματα της υβριδοποίησης είναι:

table

 

Σύμφωνα με την παραπάνω πειραματική διαδικασία, απαντήστε:

α) Για ποιο λόγο οι επιστήμονες δημιούργησαν γονιδιωματικές και όχι cDNA βιβλιοθήκες των δύο στελεχών;

β) Για ποιο λόγο δημιούργησαν τις δύο διαφορετικές βιβλιοθήκες χρησιμοποιώντας τα ίδια ένζυμα;

γ) Για ποιο λόγο συνέκριναν τις αλληλουχίες των δύο οπερονίων των δύο στελεχών; Πώς γίνεται η σύγκριση με την πέψη;

δ) Για ποιο λόγο έγινε PCR των συγκεκριμένων περιοχών του γονιδιώματος που ανήκουν στο οπερόνιο των δύο στελεχών από ολόκληρο το γονιδίωμα;

ε) Για ποιο λόγο συνέκριναν ως προς την αλληλουχία τα προϊόντα του PCR, που έγινε για στοχευμένα τμήματα του οπερονίου, αφού είχαν συγκρίνει ήδη αυτές τις περιοχές εντός των βιβλιοθηκών;

στ) Για ποιο λόγο μετά το πρώτο PCR έγινε υβριδοποίηση των βιβλιοθηκών των δύο στελεχών για τον εντοπισμό των συγκεκριμένων αλληλουχιών;

ζ) Ερμηνεύστε για ποιο λόγο το στέλεχος     εμφανίζει αυτή τη συμπεριφορά παρουσία γαλακτόζης.

Advertisements

Διαγώνισμα κεφαλαίων 8 και 9 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 

Επιλέξτε την ορθή επιλογή που συμπληρώνει σωστά την πρόταση:

  1. Στόχοι του προγράμματος του ανθρωπίνου γονιδιώματος είναι:

Α. Αλληλούχιση του γενετικού υλικού και χαρτογράφηση των γονιδίων μας.

Β. Ο προσδιορισμός των γονιδίων που σχετίζονται με τις ασθένειες

Γ. Η μελέτη της εξελικτικής μας πορείας

Δ. Η κατανόηση του ρόλου των περιοχών του γονιδιώματος μας, που δεν μεταγράφονται.

Ε. Όλα τα παραπάνω

  1. Οι απαραίτητες γνώσεις για την βιοτεχνολογική παραγωγή φαρμακευτικών πρωτεϊνών από βακτήρια, είναι:

Α. Γνώση του ιστού όπου εκφράζεται το υπεύθυνο γονίδιο, απομόνωση και κλωνοποίηση του γονιδίου, γνώση και δυνατότητα in vitro  των μετά μεταφραστικών τροποποιήσεων, οικονομικό όφελος.

Β. Χαρτογράφηση του υπεύθυνου γονιδίου, γνώση του ιστού που δρα η φαρμακευτική πρωτεΐνη, δημιουργία γονιδιωματικής βιβλιοθήκης, γνώση μετα-μεταγραφικών τροποποιήσεων in vitro.

Γ. Γνώση της αλληλουχίας του ανθρωπίνου γονιδιώματος, κατασκευή cDNA βιβλιοθήκης, οικονομικό όφελος.

Δ. Η καθολικότητα του κώδικα, η καθολικότητα των ριβοσωμάτων.

Ε. Τίποτα από τα παραπάνω.

  1. Πότε ξεκίνησε και πότε ολοκληρώθηκε το πρόγραμμα του ανθρωπίνου γονιδιώματος;

Α. Το 1986 και το 2005 αντιστοίχως

Β. Το 1990 >>>>>2001 >>>>>>>>

Γ. Το 1993 >>>>>2001 >>>>>>>>

Δ. Το 1990 >>>>>2005 >>>>>>>>

Ε. Τίποτα από τα παραπάνω.

  1. Με την δημιουργία του κλωνοποιημένου προβάτου Ντόλυ, αποδείχθηκε:

Α. Η δυνατότητα της αναπαραγωγής κλώνων ανθρώπων

Β. Ο επαναπρογραμματισμός μερικώς διαφοροποιημένων κυττάρων

Γ. Η κυτταρική διαφοροποιήση

Δ. Ότι και τα ζώα όπως και τα φυτά αναγεννιούνται από σωματικά κύτταρα.

Ε. Όλα τα παραπάνω

  1. Κατά την διαδικασία δημιουργίας διαγονιδιακών σολομών (ψάρια), πιο βήμα δεν θα πραγματοποιήθει:

Α. Η μικροέκχυση στο γονιμοποιημένο ωάριο

Β. Η in vitro γονιμοποίηση

Γ. Η τοποθέτηση του γονιμοποιημένου ωάριου στη μήτρα θετής μητέρας

Δ. Η απομόνωση σπερματοζωαρίων .

Ε. Όλα τα παραπάνω πρέπει να πραγματοποιηθούν.

Ζήτημα 2ο                                                              

Α. Ο Bob είναι ένας βελτιωμένος ταύρος γαλακτοπαραγωγής  προϊόν επιλεκτικών ομομεικτικών διασταυρώσεων και αποτελεί καθαρή σειρά. Η Bobena είναι αδελφή του Bob, με τα ίδια χαρακτηριστικά.

Επίσης, ο Sam  είναι ένας βελτιωμένος ταύρος κρεατοπαραγωγής και αυτός καθαρή σειρά. Τέλος η Samena είναι αδελφή του Sam, επίσης με τα ίδια χαρακτηριστικά όπως και ο Sam.

Οι γεωπόνοι ζωοτέχνες γενετιστές πραγματοποίησαν τις εξής διασταυρώσεις:

P1: Bob x Bobena

F1: θηλυκό Β1, αρσενικό Β2, αρσενικό Β3, θηλυκό Β4

P2: Sam x Samena

F1: αρσενικό S1, αρσενικό S2, θηλυκό S3, θηλυκό S4

P3: Bob x Samena

F1: θηλυκό BS1, θηλυκό BS2, αρσενικό BS3, αρσενικό BS4

P4: Sam x Bobena

F1: θηλυκό SB1, αρσενικό SB2, αρσενικό SB3, θηλυκό SB4

α. Ποια από τα παραπάνω άτομα έχουν μεταξύ τους τον ίδιο ακριβώς γονότυπο; (να λάβουμε υπόψη τον επιιχιασμό)

β. Ποια άτομα να αναμένεται να έχουν βελτιωμένες και τις δυο ιδιότητες (γαλακτοπαραγωγή και κρεατοπαραγωγή);

γ. Ποιοι απόγονοι αναμένεται να φέρουν στα κύτταρα τους τέσσερα ολόιδια μόρια DNA για το σύνολο των χρωμοσωμάτων τους;

δ. Ποια άτομα ονομάζονται υβρίδια;

ε. ποια άτομα παράγουν γαμέτες που είναι ολόιδιοι μεταξύ τους;

Β. Αναφέρεται τους λόγους που γνωρίζεται και είναι κατάλληλα τα ποντίκια ως πειραματόζωα.

Γ. ποιοι είναι οι στόχοι τις Ιατρικής και με ποιους τρόπους η σύγχρονη Βιοτεχνολογία τους επιτυγχάνει

Δ. Με δεδομένο ότι τα ποντίκια που θα χρησιμοποιηθούν για την παραγωγή μονοκλωνικών αντισωμάτων έναντι ενός επιλεγμένου αντιγόνου έρχονται για πρώτη φορά σε επαφή με το επιθυμητό αντιγόνο, μπορείτε να εξηγήσετε για ποιο λόγο παίρνουμε τον σπλήνα του ποντικού 15 ημέρες μετά τον εμβολιασμό του με το επιλεγμένο αντιγόνο;

Γνωρίζετε την καμπύλη της πρωτογενούς ανοσοβιολογικής απόκρισης των θηλαστικών, όπως δίνεται παρακάτω.

2017 Blog 8-9-02

Ζήτημα 3ο

Α. Σύμφωνα με την κρατούσα θεωρία για την ικανότητα του οργανισμού μας να παράγει μονάχα τα αντισώματα που αναγνωρίζουν αντιγονικούς καθοριστές (πρωτεΐνες, γλύκοπρωτεΐνες κ.α.) που ανήκουν σε ξένες προς τον οργανισμό ουσίες/σώματα, κατά την εμβρυακή ηλικία μας δοκιμάζονται τα πιθανά αντισώματα που μπορεί να φτιάξει ο οργανισμός επί των αντιγονικών καθοριστών του ίδιου του οργανισμού και καταστρέφονται τα πιθανά λεμφοκύτταρα που αναγνωρίζουν τους αντιγονικούς καθοριστές του οργανισμού μας.

Σύμφωνα με τα παραπάνω μπορείτε να εξηγήσετε για ποιο λόγο ενώ κατά την γονιδιακή θεραπεία της κυστικής ίνωσης το φυσιολογικό αλληλόμορφο ενθέθηκε επιτυχημένα στο γονιδίωμα των κυττάρων στόχων του ασθενούς και εκφράστηκε επίσης επιτυχημένα εντούτοις ο ασθενής δεν θεραπεύτηκε από την ασθένεια;

Β. δίνεται το παρακάτω γενεαλογικό δένδρο, το οποίο αφορά την γενεαλογία των πρόβατων που χρησιμοποιούνται ως πειραματόζωα σε ένα ερευνητικό εργαστήριο γενετικής βελτίωσης ζωών.

2017 Blog 8-9-03

Από το πρώτο ζευγάρι Ι1 και Ι2 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την ανθρώπινη ινσουλίνη, ενώ από το ζευγάρι Ι3 και Ι4 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την α1 αντιθρυψίνη του ανθρώπου.

Γνωρίζουμε ότι  το ανθρώπινο γονίδιο της ινσουλίνης έχει μέγεθος 2000 ζεύγη βάσεων  ενώ της α1-αντιθρυψίνης έχει μέγεθος 4000 ζεύγη βάσεων

Παρακάτω δίνονται τα αποτελέσματα των μοριακών εξετάσεων με PCR που πραγματοποιήθηκαν στα ζώα της ΙΙΙ γενεάς.

2017 Blog 8-9-04

Σύμφωνα με τα παραπάνω δεδομένα:

α. Ποια από τα άτομα της ΙΙ γενεάς είναι ή μπορεί να είναι διαγονιδιακά;

β. Ποιο από τα άτομα της ΙΙΙ γενεάς δημιουργήθηκε με όμοια τεχνολογία όπως και η Dolly και ποιο είναι κλώνος στο σύνολο του γενετικού του υλικού με το ζώο από το οποίο προήλθε;

Να αξιολογήστε την απάντηση σας.

Γ. Σε ένα άτομο διαπιστώθηκε με τα από βιοχημικές εξετάσεις η παραγωγή ινσουλίνης στο ήπαρ και όχι στο πάγκρεας, δώστε μια ερμηνεία γι΄αυτή την παρατήρηση. Ποιες περαιτέρω εξετάσεις έπρεπε να γίνουν για να γίνει δυνατή η ερμηνεία;

Ζήτημα 4ο

Σε ένα ερευνητικό ίδρυμα Γεωπονικών Εφαρμογών, οι Γεωπόνοι Βιοτεχνολόγοι, επιδιώκουν την γενετική τροποποίηση της Ελιάς με γονίδιο ενός είδους ιχθύος για την παραγωγή ελαιόλαδου εμπλουτισμένου με ω-3 λιπαρά οξέα.

Οι επιστήμονες διαθέτουν τα εξής: Τα παρακάτω καθώς και όλα τα ένζυμα της τεχνολογίας του ανασυνδυασμένου DNA  που γνωρίζετε από το σχολικό βιβλίο καθώς και όλα τα υλικά και τον τεχνικό εξοπλισμό που απαιτείται.

2017 Blog 8-9-05

Περιοριστικά έζυμα και θέσεις αναγνώρισης τους (δίνεται μόνο ο ένας από τους δυο συμπληρωματικούς κλώνους):

BamHI 5’ G/GATCC3’
HindIII 5’ AGG/CCT3’
XmaI 5’A/AGCTT3’
PstI 5’CTGCA/G3’
KpnI 5’GGTAC/C3’
SalI 5’G/TCGAC3’
XhoI 5’C/TCGAG3’

Υπόμνημα:

Υ1: Υποκινητής ενός γονιδίου που εκφράζεται στον ελαιόκαρπο.

Υ2: Υποκινητής ενός γονιδίου που εκφράζεται στον ελαιόκαρπο και στον κορμό του δένδρου.

Υ3: Υποκινητής του επιθυμητού γονιδίου του ψαριού

Υ4: Υποκινητής του Τi πλασμιδίου που εκφράζεται στα έμβρυα Ελιάς  μέχρι το στάδιο των 16 κυττάρων.

Τ- DNA : Τμήμα του Τi πλασμιδίου που ενθέτεται στο φυτικό γονιδίωμα.

Οι επιστήμονες θέλουν το ετερόλογο γονίδιο να εκφράζεται μόνο στους ελαιόκαρπους.

Το γονίδιο του ψαριού φέρει εκατέρωθεν του πλαισίου ανάγνωσης θέσεις KpnI. Καμία άλλη θέση αναγνώρισης από τις παραπάνω δεν υπάρχει στο γονίδιο αυτό.

Α. ποια περιοριστική ενδονουκλεάση θα χρησιμοποιήσουν οι επιστήμονες για να πέψουν το πλασμίδιο που δίνεται; Αιτιολογήστε την απάντηση σας.

Β. Πως θα πραγματοποιηθεί  η διάκριση των γενετικά τροποιημένων φυτών από τα μη τροποποιημένα ; αιτιολογήστε την απάντηση σας.

Γ. στο εργαστήριο είναι διαθέσιμο και ένα άλλο Τi πλασμίδιο, είναι αυτό το πλασμίδιο κατάλληλο για την γενετική τροποποίηση της Ελιάς;

2017 Blog 8-9-06

Υπόμνημα:

Υ1: Υποκινητής ενός γονίδιου που εκφράζεται αποκλειστικά στον ελαιόκαρπο.

Υ2: Υποκινητής ενός γονιδίου ογκογενετικού του πλασμιδίου Τi.

Υ3: Υποκινητής καθολικός φυτικός της Ελιάς.

Υ4: Υποκινητής του γονιδίου ανθεκτικότητας στο αντιβιοτικό τετρακυκλίνη.

Δ. Μετά από την επιτυχημένη δοκιμασία γενετικής τροποποίησης της Ελιάς. Οι επιστήμονες θέλουν να δημιουργήσουν φυτά ομόζυγα για το ετερόλογο γονίδιο αυτό. Πώς μπορούν να το επιτύχουν αυτό;

Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Ζήτημα 1.                                                                                                                           Μονάδες 25

  1. Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BamHI είναι:

5′ G|GATCC 3′

3′ CCTAG|G 5′

Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BclI είναι:

 5′ T|GATCA 3′

 3′ ACTAG|T 5′

Ένα γραμμικό μόριο DNA διαθέτει μοναδική θέση αναγνώρισης BamHI και ένα άλλο μόριο επίσης γραμμικό, με την ίδια κατά τα άλλα, ακριβώς αλληλουχία διαθέτει μοναδική θέση BclI, στη θέση της BamHI. Τα δυο μόρια πέπτονται ανεξάρτητα το ένα από το άλλο με την κατάλληλη περιοριστική ενδονουκλεάση το καθένα. Τα προϊόντα της πέψης αναμιγνύονται και προστίθεται το ένζυμο DNA δεσμάση. Στο τελικό μείγμα προστίθονται και οι δυο περιοριστικές ενδονουκλεάσες BamHI και BclI.

 Δημιουργούνται:

α. 4 διαφορετικά μόρια DNA

β. 2 διαφορετικά μόρια DNA

γ.1 μόριο DNA

δ. 2 όμοια μόρια DNA

 2. Στο παραπάνω μείγμα:

α. δρουν και οι δυο περιοριστικές ενδονουκλεάσες πάντα

β. δρα μόνο η μια από τις δυο περιοριστικές ενδονουκλεάσες πάντα

γ. μπορεί να δράσει ή η μια ή άλλη περιοριστική ενδονουκλεάση

δ. μπορεί να μην δράσει καμιά από τις δυο περιοριστικές ενδονουκλεάσες.

 3. Ποια από τις παρακάτω αλληλουχίες αποτελεί πιθανή θέση αναγνώρισης κάποιας περιοριστικής ενδονουκλεάσης;

α. 5’A|CTGC3′

3’TGAC|G5′

β. 5′ T|TTAAA3′

3’AAATT|T5′

γ. 5′ G|GATCA3′

3′ CCTAG|T5′

δ. 5’G|AATTC3′

 4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη:

α. Για το γονίδιο της EcoRI, β. Για το γονίδιο του tRNA της Aργινίνης των λευκοκυττάρων μας

γ. Για το οπερόνιο της λακτόζης, δ. Για το γονίδιο της αντίστροφης μεταγραφάσης του HIV.

 5. Ένας φορέας κλωνοποίησης διαθέτει εκτός από το γονίδιο ανθεκτικότητας στην καναμυκίνη (αντιβιοτικό) και το γονίδιο LeuI που κωδικοποιεί το ένζυμο το οποίο απαιτείται για την σύνθεση του αμινοξέα Λεύκινη και μπορεί να χρησιμοποιηθεί ως γονίδιο για την επιλογή των μετασχηματισμένων ξενιστών με το ανασυνδυασμένο πλασμίδιο.

Ποιο γονότυπο και ποιο φαινότυπο πρέπει να εμφανίζουν τα επιθυμητά κύτταρα ξενιστές;

α. Πριν το μετασχηματισμό ήταν LeuI- και μετά τον μετασχηματισμό αυξάνονται σε περιβάλλον δίχως Λεύκινη.

β. Πριν το μετασχηματισμό ήταν LeuI+ και μετά το μετασχηματισμό δεν αυξάνεται σε περιβάλλον δίχως Λεύκινη

γ. Μετά το μετασχηματισμό ήταν LeuI- και αυξάνεται σε περιβάλλον δίχως Λεύκινη

δ. Μετά το μετασχηματισμό ήταν LeuI+ και δεν αυξάνεται σε περιβάλλον δίχως Λευκινη

 Ζήτημα 2                                                                                                                            Μονάδες 25

  1. Διαθέτετε το γονίδιο Ψ2 και θέλετε να το ενθέσετε εντός του φορέα κλωνοποίησης Β2 οποίος διαθέτει τις εξής θέσεις περιορισμού (οι αλληλουχίες είναι δίκλωνες αλλά δίνονται μόνο ο ένας από τους δυο κλώνους).

StuI : 5′ AGG|CCT3′                                                                                           SalI: G|TCGAC3′

Ψ2:5′ TCCGGCGGAATTCCAAGGCCT[ΑΤG…κωδική περιοχή]CGTCGACTCCGGC 3′

       3′ AGGCCGCCTTAAGGTTCCGGA[TAC…κωδική περιοχή]GCAGCTGAGGCCG 5′

 Τμήμα του Β2 _________Διεύθυνσης μεταγραφής_>____StuI_____SalI____EcoRI__________͢

α. Υπάρχουν δυο διαφορετικοί τρόποι ένθεσης του γονιδίου Ψ2 (κωδική περιοχή του) στο πλασμίδιο Β2. Ποιο είναι αυτοί; Ποιο περιοριστικό ένζυμο θα χρησιμοποιήσετε  για να πεψετε το πλασμίδιο και το γονίδιο ώστε να απομονώσετε μόνο την κωδική περιοχή του γονιδίου;                                                                                                                                             Μοναδες 10

β. Ποιος από τους δυο αυτούς τρόπους είναι ο κατάλληλος για να είναι δυνατή η έκφραση του γονιδίου Ψ2 στο κύτταρο ξενιστή (μονάδες 5); Αιτιολογήστε την απάντηση σας.                                                                                                                                                  Μονάδες 10

 Ζήτημα 3                                                                                                                            Μονάδες 25

  1. Εξηγήστε πως θα μπορούσαμε να παράξουμε την αιμοσφαιρίνη Α, που αποτελείται από 2 α και 2 β πολυπεπτιδικές αλυσίδες , από βακτήρια με την τεχνολογία της cDNA βιβλιοθήκης.
  2. Δίνεται το παρακάτω υποθετικό γονίδιο του λ φάγου που κωδικοποιεί για ένα ολιγοπεπτιδιο. Το γονίδιο αυτό θέλουμε να το κλωνοποιησουμε με σκοπό την παραγωγή του ολιγοπεπτιδίου που κωδικοποιεί σε ζυμομύκητα.

…_________________________________________________________________…

ΥATTGCGGAATTCAAATGCCCAGTTCATGTAGAATTCTAAGCGC

 

            YTAACGCCTTAAGTTTACGGGTCAAGTACATCTTAAGATTCGCG

…_________________________________________________________________…

Για την κλωνοποιήση του συγκεκριμένου γονίδιου θα επιλέξετε μεταξύ των παρακάτω φορέων κλωνοποιήσης.

2017 inmid-01Σημείωση:Η θέση περιορισμού δίπλα στον υποκινητή τόσο του ενός όσο και του άλλου πλασμιδιου είναι η θέση αναγνώρισης της περιοριστικής ενδονουκλεασης EcoRI.

Στο πλασμίδιο 1 ο εσωτερικός μητρικός κλώνος όταν αντιγράφεται στη διχάλα που εξελίσσεται προς τα αριστερά ο νεοσυντιθέμενος συμπληρωματικός κλώνος συντίθεται συνεχώς. Στο πλασμίδιο 2 ο αντίστοιχος μητρικός κλώνος στη διχάλα που εξελίσσεται προς τα δεξιά ο νεοσυντιθέμενος συμπληρωματικός κλώνος συντίθεται συνεχώς.

Α. Ποια είναι κωδική και ποια μη κωδική αλυσίδα του γονιδίου του λ-φάγου;

Β. Ποιο ολιγοπεπτίδιο κωδικοποιεί αυτό το γονίδιο;

Γ. Ποιο από τα πλασμιδια θα χρησιμοποιήσετε για την κλωνοποιήση του γονιδίου και αιτιολογήστε την απάντηση σας.

Δ. Μετά την επιτυχή έκφραση του γονιδίου στα κύτταρα ξενιστές απομονώθηκαν δυο διαφορετικά ολιγοπεπτίδια που παράγονται από τα μετασχηματισμένα κύτταρα ζυμών με τα ανασυνδυασμενα πλασμιδια. Τα δυο αυτά ολιγοπεπτιδια παράγονται από διαφορετικά μετασχηματισμένα μυκητιακα κύτταρα. Δηλαδή το ίδιο κύτταρο δεν παράγει και τα δυο ολιγοπεπτιδια. Και τα δυο είναι προϊόντα έκφρασης του ετερολογου γονιδίου που ανασυνδυάστηκε με τον φορέα κλωνοποιήσης.

Εξηγήστε το φαινόμενο.

Ε. Είναι δυνατόν το κύτταρο ζύμης ξενιστής να παράγει το λειτουργικό ολιγοπεπιδιο του λ-φαγου δεδομένου ότι ο λ-φαγος προσβάλει βακτηρία;

 

Ζήτημα 4                                                                                                                            Μοναδες 25

Δίνεται η παρακάτω αλληλουχία του γονιδίου Φ1 (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) που κωδικοποιεί για το ένζυμο του βακτηρίου Lactobacillus arabinosus που σχηματίζει την βιταμίνη Β9 (φολικό οξύ).

Από την γονιδιωματική βιβλιοθήκη του βακτηρίου απομονώθηκε το γονίδιο Φ1 με στόχο την εισαγωγή του σε κατάλληλο φορέα κλωνοποίησης που θα μετασχηματίσει κύτταρα ζυμών αρτοποιίας ώστε να εμπλουτίζεται το ψωμί με φολικό οξύ.

Στο δοθέν γονίδιο δεν περιλαμβάνεται η αλληλουχία του υποκινητή του. Υποδεικνύονται τα κωδικόνια έναρξης και λήξης του Φ1 και εντός των 1500 ζ. β. που παρεμβάλλονται μεταξύ των κωδικονίων έναρξης και λήξης δεν υπάρχουν θέσεις αναγνώρισης των περιοριστικών ενζύμων: XbaI (5′TCTAGA3′ ), SacI (5′GAGCTC3′ ), BamHI (5′GGATCC3′), BglIi(5′AGATCT3′), NdeI(.5′CATATG 3′ )

5′ GTCTAGAAGAGCTCCTTGGATCCAAAGATCTACCATATGTCTCGCCTA   1500 συνέχεια γονίδια

5’GTCTAGAAGAGCTCTGGATCCAAGATCTACCATATGTAAGCG3′

Δίνεται επίσης ο φορέας κλωνοποίησης που θα χρησιμοποιηθεί για την κλωνοποίηση του γονιδίου Φ1 στη ζύμη αρτοποιίας. Δίνεται ακόμη η αλληλουχία του φορέα κλωνοποίησης (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) από τη θέση BglI μέχρι τη θέση SacI, όπου περιλαμβάνεται και ο υποκινητής που θα είναι υπεύθυνος για τη μεταγραφή του γονιδίου Φ1.

Τμήμα του φορέα κλωνοποίησης:

__________Διεύθυνση μεταγραφής>___XbaI__NdeI___BamHI___SacI_____________________

Υποκινητής

———————->

5′AGATCTCGATCCCCCGAAATTAATACGACTCACTATACGGGAATTGTCACCGCATAACAATTCCCCTCTAGAAATAATT

5΄TTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAA

MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlu

5’TCGAGCTCCGTCGAC3′

LeuArgArgGlnAla

α. Για την έκφραση του γονιδίου Φ1 στη ζύμη, ποιες πρωτεΐνες και από ποιον οργανισμό θα πρέπει να συνδεθούν με τον υποκινητή του φορέα κλωνοποίησης που θα χρησιμοποιηθεί;

Μονάδες 8

β. Αν υποθέσουμε ότι τα επιπλέον αμινοξέα στο αμινοτελικό άκρο της πρωτεΐνης που κωδικοποιείται από το Φ1 γονίδιο δεν επηρεάζουν την λειτουργικότητα της απαντήστε στις παρακάτω ερωτήσεις:

  1. I) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με πέψη με BamHI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικέ με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

ΙΙ) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με με πέψη με το ένζυμο SacI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικέ με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

Μονάδες  4Χ4=16

 

 

 

 

Διαγώνισμα κεφαλαίων 1-2 Βιολογίας Θετικού Προσανατολισμού

ΔΙΑΓΩΝΙΣΜΑ

ΚΕΦΑΛΑΙΟ 1Ο – 2Ο

ΘΕΜΑ Α                                                                                                                                                                                       ΜΟΝΑΔΕΣ 25

Να απαντήσετε στις παρακάτω ερωτήσεις επιλέγοντας την λανθασμένη πρόταση ανάμεσα στις σωστές ή την σωστή ανάμεσα στις λανθασμένες.

Α. Το καλαμπόκι (zea mays) έχει μεγαλύτερη ποσότητα DNA στον πυρήνα του, απ’ ότι έχει ο άνθρωπος. Έτσι, αναμένουμε :

α. Το καλαμπόκι έχει περισσότερα χρωμοσώματα από τον άνθρωπο.

β. Ο άνθρωπος είναι σίγουρα εξελικτικά κατώτερος από το φυτό αυτό.

γ. Ο άνθρωπος και το καλαμπόκι έχουν τον ίδιο λόγο και τον ίδιο καρυότοπο και την ίδια αλληλουχία βάσεων , αλλά θα διαφέρουν ως προς την διαζώνωση.

δ. Το καλαμπόκι δεν αποκλείεται να έχει λιγότερα χρωμοσώματα από τον άνθρωπο, και διαφορετικό λόγο , και διαφορετικό

καρυότυπο από τον άνθρωπο.

Β. Μιτογόνος ουσία είναι ……………… και ουσία που σταματάει την κυτταρική διαίρεση στην μετάφαση της μίτωσης είναι η…………………

α) φυτοαιματογλουτίνη , κολχικίνη

β) κολχικίνη, φυτοαιματογλουτίνη

γ) υπότονο διάλυμα , Giemsa

δ) Giemsa , υπότονο διάλυμα

Γ. Στον γενετικό κώδικα υπάρχουν ………………… αμινοξέα που κωδικοποιούνται μονοσήμαντα, ……………… αμινοξέα που κωδικοποιούνται από έξι κωδικόνια συνώνυμα μεταξύ τους και δεν υπάρχει κανένα αμινοξύ που να κωδικοποιείται από …………… συνώνυμα κωδικόνια.

α. 2, 4, 1

β. 2, 6, 7

γ. 2, 5, 3

δ. 2, 3, 5

4. Η αναδίπλωση των χρωμοσωμάτων των ευκαρυωτικών κυττάρων είναι σταδιακά από τη διπλή έλικα με διάμετρο…………….nm , σε …………….. 11 nm και κατόπιν σε ινίδιο χρωματίνης ………………… nm. Σε αυτό το στάδιο το χρωμόσωμα είναι παρατηρήσιμο με ……………….. …………….

5. Δίνεται το παρακάτω μόριο mRNA:

UACUACCACCAUGCCCAUGCCCGAGCGCUAGCCCAUG

α) Ποια είναι η κωδική αλυσίδα του γονιδίου που το κωδικοποιεί ;

β) Ποια είναι η μη-κωδική αλυσίδα του γονιδίου που κωδικοποιεί το RNA μόριο που συνδέεται με το 5ο κωδικόνιο;

γ) Ποια είναι η κωδική αλυσίδα του γονιδίου rRNA που αναγνωρίζει τμήμα τεσσάρων νουκλεοτιδίων στην 5αμετάφραστη περιοχή του mRNA ;

1.

Α) 3’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG 5’

B) 5’ ATGCCCTAGCGCGAGCCCATGCCCATGACCACTT3’

Γ) 5’ TACTACCACCATGCCCATGCCCGAGCGCTAGCCCATG3’

Δ)5’ΤACTACCCACCCATGCCCATGCCCGAGCGCTAGCCCATG3’

2.

A)5’AACCATGGAGCTCTGACCAA3’……

B)5’AACCATGCTCGTGTGACCAA3’…….

Γ)3’AACCCTCATGTGACTCCCAA…….

Δ)ΑACCATGCTCGTGTGACCAA5’…….

3.

A)5’ACCTACGCAC3’……..

B)3’ACGATGCACC5’……..

Γ)3’ATGCCCGAT5’………

Δ)3’CAGCTGGTGA5’……….

ΘΕΜΑ Β                                                                                                                                                                                   ΜΟΝΑΔΕΣ 25

Α. Να συμπληρωθεί ο πίνακας που παρουσιάζεται παρακάτω :

  1. 1. DNA<==> RNA–> ΠΟΛΥΠΕΠΤΙΔΙΟ
  1. 2. DNA—>  RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ
  1. 3. DNA—>RNA—> ΠΟΛΥΠΕΠΤΙΔΙΟ

4. DNA<===>  RNA—-> ΠΟΛΥΠΕΠΤΙΔΙΟ

5. DNA—-> RNA<===> ΠΟΛΥΠΕΠΤΙΔΙΟ

α) Μέσα σε ρετροϊούς.

β) Μιτοχόνδρια, κύτταρα, χλωροπλάστες.

γ) Κύτταρα μολυσμένα από ρετροϊούς.

δ) Κύτταρα μολυσμένα από RNA ιούς με δίκλωνο RNA.

ε) Μέσα σε ιούς

ζ) Δεν έχει ανακαλυφθεί τέτοια περίπτωση σε έμβια όντα.

Σημείωση: Σε κάθε παραπάνω περίπτωση ισχύει και η αντιγραφή του DNA ενώ στην 1η και 3η περίπτωση ισχύει και η αντιγραφή RNA.

5 ΜΟΝΑΔΕΣ

Β. Σε ποια στάδια της έκφρασης της γενετικής πληροφορίας σ’ ένα ανθρώπινο κύτταρο βρίσκει εφαρμογή η συμπληρωματικότητα;


4 ΜΟΝΑΔΕΣ

Γ. Να υπολογιστεί το πλήθος των νουκλεοσωμάτων ενός ανθρώπινου γαμέτη, αν γνωρίζεται ότι υπάρχουν νουκλεοσώματα στα άκρα των χρωμοσωμάτων και μεταξύ δύο νουκλεοσωμάτων υπάρχουν 54 ζεύγη νουκλεοτιδίων.

5 ΜΟΝΑΔΕΣ

Δ. Ένας οργανισμός με γονιδίωμα 16 χρωμοσωμάτων πόσα μόρια DNA έχει το κάθε κύτταρο της 1ης μειωτικής διαίρεσης του. Πόσοι από τους κλώνους του DNA σε κάθε κύτταρο από αυτά τα κύτταρα, είναι πανομοιότυποι και πόσοι είναι συμπληρωματικοί μεταξύ τους.

3+3 ΜΟΝΑΔΕΣ

Ε. Αντιστοιχίστε με ποιο τρόπο είναι δυνατή η παρατήρηση των κυτταρικών δομών της πρώτης στήλης με τις μεθόδους της δεύτερης στήλης.

1)ΜΟΡΙΟ DNA

2)NOYΚΛΕΟΣΩΜΑ

3)ΜΕΤΑΦΑΣΙΚΟ ΧΡΩΜΟΣΩΜΑ

4)ΠΛΑΣΜΙΔΙΟ

5)ΘΗΛΙΑ ΑΝΤΙΓΡΑΦΗΣ

α)ΚΡΥΣΤΑΛΛΟΓΡΑΦΙΑ ΑΚΤΙΝΩΝ Χ

β) ΗΛΕΚΤΡΟΝΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

γ)ΟΠΤΙΚΟ ΜΙΚΡΟΣΚΟΠΙΟ

5 ΜΟΝΑΔΕΣ

ΘΕΜΑ Γ

Α. Δίνονται δύο βακτήρια διαφορετικού είδους που το καθένα διαθέτει από ένα πλασμίδιο.

Το βακτήριο (Α) διαθέτει το πλασμίδιο (α) που φέρει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό str και τον παράγοντα μεταφοράς F+, καθώς και το γονίδιο (i)

(P)

Γονίδιο (i)

GAAATGGAATTCTGAAAATTT Υ (P)

CTTTACCTTAAGACTTTTAAA Υ

Το πλασμίδιο (β) που διαθέτει το κύτταρο (B), έχει ένα γονίδιο ανθεκτικότητας στο αντιβιοτικό Amp , και το γονίδιο (ii)

Γονίδιο (ii)

                         Υ CCATCATCGAAATGGAATTCTGAAAATTTCCTATT

(P)Y GGTAGTAGCTTTACCTTAAGACTTTTAAAGGATAA

Όπου (P) φωσφορική ομάδα.

Μεταξύ των βακτηρίων (Α) και (Β) πραγματοποιήθηκε βακτηριακή σύζευξη. To βακτήριο δέκτης του πλασμιδίου, δεν μπορεί πλέον ν’ αξιοποιήσει λειτουργικά το προϊόν που κωδικοποιούσε πριν από τη σύζευξη του το γονίδιο του πλασμιδίου του, όμως, παραμένει ανθεκτικό στο αντιβιοτικό στο οποίο διέθετε ανθεκτικότητα.

Σημείωση: Τα δύο πλασμίδια δεν ανασυνδυάζονται.

α. Τι γνωρίζεται για τα πλασμίδια; 5 ΜΟΝΑΔΕΣ

β. Ποια είναι η κωδική αλυσίδα του γονιδίου (ii) ; 1 ΜΟΝΑΔΑ

Αιτιολογήστε την απάντηση σας. 7 ΜΟΝΑΔΕΣ

γ. Εξηγήστε για ποιον λόγο το βακτήριο δέκτης, όπως αναφέρεται στην εκφώνηση, δεν μπορεί πλέον να χρησιμοποιεί το προϊόν της μεταγραφής του γονιδίου του. 7 ΜΟΝΑΔΕΣ

Β. Γνωρίζετε ότι η βακτηριακή DNA πολυμεράση κινείται με ταχύτητα 50 νουκλεοτίδια / δευτερόλεπτο. Σε πόσο χρόνο αναμένετε ότι θα ολοκληρωθεί η αντιγραφή του πλασμιδίου του βακτηρίου Α το οποίο έχει μέγεθος 5000 ζεύγη νουκλεοτιδίων;

Αν :

α) Στη θέση έναρξης της αντιγραφής του πλασμιδίου δημιουργείται μια θηλιά που αποτελείται από δύο αμφίδρομες διχάλες, όπου δρουν τέσσερα μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

β) Στη θέση έναρξης της αντιγραφής δημιουργείται μία θηλιά με δύο διχάλες αμφίδρομες , όπου δρουν δύο μόρια DNA πολυμερασών για την επιμήκυνση των νέων κλώνων.

3 ΜΟΝΑΔΕΣ

γ) Να αποδώσετε τα δύο σχήματα. 2 ΜΟΝΑΔΕΣ

ΘΕΜΑ Δ

Α. Σ’ ένα κύτταρο εκτελείται η διαδικασία της μετάφρασης, ένα ριβόσωμα φέρει ένα μόριο tRNA που μεταφέρει ένα πεπτίδιο με τριάντα πεπτιδικούς δεσμούς και μόλις μετακινείται κατά μία θέση, ώστε αυτό το tRNA να βρεθεί στην πρώτη θέση του ριβοσώματος. Το ολοκληρωμένο πρόδρομο πολυπεπτίδιο αποτελείται από 100 αμινοξέα. Σε ποια νουκλεοτίδια του μεταφράσιμου τμήματος του mRNA βρίσκεται το παραπάνω ριβόσωμα και σε ποια κωδικόνια ; 6 ΜΟΝΑΔΕΣ

Β. Ένα έμβρυο με καρυότοπο 46 χρωμοσωμάτων διαθέτει 3 χρωμοσώματα 21 και ένα φυλετικό χρωμόσωμα χ.

α) Πόσα μόρια DNA διαθέτει το έμβρυο αυτό στον καρυότοπο του;

β) Πόσους κλώνους DNA διαθέτει το έμβρυο αυτό στην φάση G1 ενός σωματικού κύτταρου του;

γ) Το έμβρυο αυτό πόσα ζεύγη ομόλογων χρωμοσωμάτων διαθέτει;
δ) Το έμβρυο αυτό είναι διπλοειδές άτομο;

ε) Το έμβρυο αυτό έχει πυρηνικό γονιδίωμα όσο και ένα φυσιολογικό κορίτσι; 5ΜΟΝΑΔΕΣ

Γ. Σας δίνεται μέρος από την κωδική και μη-κωδική αλυσίδα ενός γονιδίου.

CTTCCTTGAGAATGGGGCCCTTAATTGGCT

              AACTCTTACCCCGGGAATTAACCGACTTCC

α) Να βρεθεί ο προσανατολισμός της ως προς τη θέση του υποκινητή.

β) Να γραφεί το μόριο του RNA που θα προκύψει αν το παραπάνω μόριο μεταγράφει σε εκχύλισμα μιτοχονδρίων του ανθρώπου.

3+3 ΜΟΝΑΔΕΣ

Δ. Ένα βακτήριο E. coli έχει μετασχηματιστεί μ’ ένα πλασμίδιο πάνω στο οποίο φέρεται ολόκληρο το οπερόνιο της λακτόζης αλλά απουσιάζει το ρυθμιστικό γονίδιο.

Το βακτήριο αυτό ωστόσο, δεν μπορεί ν’ αναπτυχθεί σε περιβάλλον με μοναδική πηγή C τη λακτόζη.

Εξηγήστε δύο λόγους για τους οποίους είναι δυνατόν να γίνεται αυτό. 8 ΜΟΝΑΔΕΣ

ΚΑΛΗ ΕΠΙΤΥΧΙΑ

Επαναληπτικό Διαγώνισμα Βιολογίας Θετικού Προσανατολισμού κεφαλαίων 1,2,4 &7

Ζήτημα 1.

Α. Επιλέξτε την ορθή απάντηση:

  1. κατά την μεταγραφη των γονιδιων του οπερονιου της λακτοζης δημιουργουνται…………………. mRNA

Α. 1, β. 2, γ. 3, δ.4                                                                     (5 μονάδες)

  1. Από τα ………διαφορετικα κωδικονια , …………κωδικοποιουν αμινοξεα και ………οδηγουν στον τερματισμο της πρωτεινοσυνθεσης.

Α. 180, 20, 4 β. 20, 17, 3 γ. 20, 17, 4, δ. 64, 61, 3                                     (5 μοναδες)

  1. Σωστο – Λαθος:

Α. Για να κατασκευστει μια cDNA βιβλιοθηκη απομονωνεται το ολικο mRNA από κυτταρα που εκφραζουν το γονιδιο που θελουμε να μελετησουμε.

Β. Η μεταβολή του πληθυσμού σε συνάρτηση με τον χρόνο μιας συνεχούς καλλιέργειας φυσιολογικών κυττάρων E.coli, εμφανίζει καμπύλη διαύξησης.

Γ. Στην αντιγραφή του βακτηριακου DNA συμμετέχουν 2 DNA πολυμερασες.

Δ. Ένα φυσιολογικο ανθρωπινο σωματικο κυτταρο εχει στον πυρηνα του 24* 10 9 βασεις κατά την μεταφαση της μιτωσης του.

Ε. κατά την πεψη ενός κυκλικου μοριου DNA από την EcoRI σπαζουν περισσοτεροι φωσφοδιεστερικοι δεσμοι από ότι ενός γραμμικου μοριου DNA.

Δινεται ότι το κάθε μοριο διαθετει 4 θεσεις αναγνωρισης της EcoRI.                (15 μοναδες)

Ζητημα 2

Α. Γιατι τα κυτταρα ενός πολυκυτταρου οργανισμου, παροτι εχουν όλα τα ιδια γονιδια  διαφερουν στην μορφη και την λειτουργια τους; (5 μοναδες)

Β. Ένα διπλοειδες κυτταρο υφισταται μιτωση και στη συνεχεια  τα θυγατρικα κυτταρα υφιστανται μειωση.

Σχεδιαστε ένα κοινο διαγραμμα οπου θα φαινονται οι μεταβολες της ποσοτητας του γενετικου υλικου του ενός κυτταρου σε σχεση με το χρονο. Αιτιολογηστε την απαντηση σας.

Δινεται ότι το γενετικο υλικο του πυρηνα του κυτταρου, κατά την μεταφαση της μιτωσης του, εχει μηκος 4* 10 8 ζευγη βασεων. (10 μοναδες)

Γ. Στο παρακατω σχημα φαινεται η διχαλα αντιγραφης ενός πλασμιδιου. Αφου μεταφερετε το σχημα στο τετραδιο σας, συμπληρωστε τον προσανατολισμο των αλυσιδων στα ακρα της διχαλας, καθως και τον προσανατολισμο της αντιγραφης σε κάθε αλυσιδα. Τελος, να χαρακτηρισετε τον τροπο συνθεσης των νεων αλυσιδων του DNA.

2017 Επαναλληπτικό 1 2 4 7-01

Αιτιολογηστε συντομα την απαντηση σας.  (2+2+2+4 = 10 μοναδες)

Ζητημα 3

Μια συνεχης καλλιεργεια βακτηριων E. coli περιεχει εξαρχης δυο στελεχη βακτηριων. Τα βακτηρια που ανηκουν στο ένα στελεχος διαθετουν ένα πλασμιδιο το οποιο περιεχει ένα γονιδιο ανθεκτηκοτητας στο αντιβιοτικο καναμυκινη. Τα βακτηρια που ανηκουν στο άλλο στελεχος διαθετουν ένα διαφορετικο πλασμιδιο που φερει ένα διαφορετικο γονιδιο ανθεκτικοτητας στην καναμυκινη ( το οποιο κωδικοποιει την ιδια πρωτεινη με το γονιδιο ανθεκτικοτητας του πρωτου πλαδμιδιου), και ένα γονιδιο ανθεκτικοτητας στην πενικιλινη.

Τα βακτηρια  της καλλιεργειας αναπτυσονται σε ζυμωτηρα στον οποιο προσθετουμε την χρονικη στιγμη τ1 χ ποσοτητα καναμυκινης, την στιγμη τ2 y/2 ποσοτητα πενικιλινης και την στιγμη τ3 y ποσοτητα πενικιλινης.

Το ακολουθο διαγραμμα δειχνει τις μεταβολες στον πληθυσμο των μικροοργανισμων σε σχεση με τον χρονο.

2017 Επαναλληπτικό 1 2 4 7-02

Α. Να εξηγησετε γιατι, παροτι και τα δυο στελεχη διαθετουν ένα γονιδιο ανθεκτικοτητας στην καναμυκινη, μετα την προσθηκη του αντιβιοτικου στο θρεπτικο υλικο την χρονικη στιγμη τ1, παρουσιαζεται μερικη μειωση του πληθυσμου των βακτηριων. (5 μοναδες)

Β. Να χαρακτηρισετε κάθε φαση της καλλιεργειας όπως εμφανιζεται στο διαγραμμα και να αιτιολογησετε την απαντηση σας. (5 μοναδες)

Γ. Να εξηγησετε γιατι τα βακτηρια της καλλιεργειας «αντιδρουν» διαφορετικα αναμεσα στις δυο περιπτωσεις προσθηκης πενικιλινης.(5 μοναδες)

Δ. Σε μια νεα δημιουργια της καλλιεργειας, προσθετουμε μικροτερες ποσοτητες καναμυκινης και πενικιλινης σε σχεση με τις αρχικες. Πιστευετε ότι αυτό θα επηρεασει τον ρυθμο αναπτυξης των βακτηριων της καλλιεργειας; Να αιτιολογησετε την απαντηση σας. Σχεδιαστε το νέο πιθανο διαγραμμα του ρυθμου αναπτυξης των βακτηριων συμφωνα με την απαντηση σας. Υποθεστε ότι οι προσθηκες των αντιβιοτικων εγιναν στις ιδιες αντιστοιχες στιγμες όπως φαινονται στο διαγραμμα που σας δοθηκε. (2+3+5=10)

Ζητημα 4

Τρια δειγματα πλασμιδιακου DNA πεπτονται με διαφορες περιοριστικες ενδονουκλεασες και στη συνεχεια αναλυονται σε πηκτωμα αγαροζης. Τα αποτελεσματα είναι αυτά που φαινονται στις εικονες. Γνωριζετε ότι κανενα πλασμιδιο δεν εχει δυο ιδιες θεσεις αναγνωρισης. Επισης είναι γνωστο ότι το πλασμιδιο 1  εχει μηκος 20.000 ζευγη βασεων, το πλασμιδιο 2 εχει μηκος 15.000 ζευγη βασεων  και το πλασμιδιο 3 εχει μηκος 10.000 ζευγη βασεων.

2017 Επαναλληπτικό 1 2 4 7-03

2017 Επαναλληπτικό 1 2 4 7-04

Σημείωση: Στο τρίτο πηκτωμα αγαροζης με την σειρά  που δίνονται στο πρώτο πλασμιδιο η ζώνη στις 10.000 ζεύγη νουκλεοτιδιων είναι διπλάσια σε πάχος από όλες τις υπολοίπων των τεσσάρων πηκτωματων αγαροζης.

Α. Σχεδιαστε τον περιοριστικο χαρτη καθε πλασμιδιου (για το πλασμιδιο 1 αρκει μια εκδοχη). Δεν απαιτηται αιτιολογηση. (6 μοναδες).

Β. Δινεται η αλληλουχια ενός  υποθετικου γονιδιου του πλασμιδιου 2 που κωδικοποιει τη συνθεση μιας πρωτεινης.

Αλυσιδα1. …TCGACGGGTACGCTATGCGCCGTTTTGTAAAAACGAGGACTTTG…

Αλυσιδα 2….ΑGCTGCCCATGCGATACGCGGCAAAACATTTTTGCTCCTGAAAC…

Η υπογραμμιση δηλωνει την 5΄αμεταφραστη περιοχη .

  1. ποια αλυσιδα είναι η κωδικη και ποια η μη κωδικη και σημειωστε τα 5΄και 3΄ακρα της κάθε αλυσιδας. Αιτιολογηστε την απαντηση σας. (μοναδες 5).
  2. Ο υποκινητης του παραπανω γονιδιου αποτελειται από 120 βασεις. Από αυτές, το 15% είναι αδενινες. Να βρειτε τα ποσοστα και τους αριθμους των υπολοιπων. (μοναδες 3).

Γ. Δινεται το ακολουθο γονιδιο το οποιο κωδικοποιει τη συνθεση μιας πρωτεινης του ανθρωπου:

5’ AGCGAATTCGCTCTGCAG…GGATCC…GCTAT…ATG…GAATTC…TAGCTGCAG…GGATCC3’

3’ TCGCTTAAGCGAGACGTC…CCTAGG…CGATA…TAC…CTTAAG…ATCGACGTC…CCTAGG5’

3’ ΑΜΕΤΑΦΡΑΣΤΗ ΑΛΜ

Οπου ΑΛΜ= Αλληλουχιες ληξης της Μεταγραφης. Οι ΑΛΜ βρισκονται στις αλληλουχίες που ακολουθουν αμεσως μετα την 3′ αμεταφραστη περιοχη του δοθεντος γονιδιου. Η αλληλουχία του υποκινητή είναι η υπογραμμισμένη στα αριστερά αλληλουχία του γονιδίου που δίνεται.

Να προσδιορισετε ποια/ποιες περιοριστικη/ες ενδονουκλεαση/ες μπορει/ουν να χρησιμοποιηθει/ουν για την πεψη του γονιδιου, ώστε στη συνεχεια να ενθεθει ακεραιο σε καποιο από τα πλασμιδια του προηγούμενου ερωτήματος και να μπορει να εκφραζεται επιτυχως. Να αιτιολογηθει η απαντηση σας.

Δ. Να προσδιορισετε ποιο/α πλασμιδιο/α θα μπορουσε/αν να χρησιμοποιηθει/ουν ως φορεας/εις κλωνοποιησης για το γονιδιο του προηγουμενου ερωτηματος, με βαση την απαντηση σας στο προηγουμενο ερωτημα. Να εξηγησετε επισης ποιες άλλες προυποθεσεις θα πρεπει να πληροι/ουν αυτό/α το/τα πλασμιδιο/α ώστε να μπορει να χρησιμοποιηθει επιτυχως ως φορεας κλωνοποιησης.

(μοναδες 2+4=6)

Δίνονται:

Θέση αναγνώρισης της PstI……………… Θέση αναγνώρισης της BamHI

5’ CTGCAG3’…………………………………………………………5’GGATCC3’

3’ GACGTC5’ …………………………………………………………3’CCTAGG5’

 

Δημιουργημένο απο την α’ φοιτήτρια της Ιατρικής Κωνσταντίνα Ραουζαίου

Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

Α. Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                                                  Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρίων. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρνών  στο έμβρυο. (7)

  1. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)
  2. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία του γονιδίου β των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως , ακριβώς πριν από την έναρξη των 95 νουκλοτιδίων; (2)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1)

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (2)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (2)

2.

α. Σε ένα άτομο πάρθηκαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥ+44. Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (5)

β. Εξηγήστε αν είναι δυνατόν να προκύψουν μονοζυγωτικά δίδυμα διαφορετικού φύλου.(5)

 

 Ζήτημα 4ο                                                                                                                  Μονάδες 25

 

Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

 

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής ανομίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

 

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

Α. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

Γ. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

Δ. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

Ε. Πιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

ΣΤ. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Διαγώνισμα κεφαλαίου 7 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1                                                                    μονάδες 25

A. Επιλέξτε την σωστή πρόταση:                                                        μόρια 10

1. Τα μικροβιακά κύτταρα για να διαιρεθούν :

1. Πρέπει να έχουν το κατάλληλο μέγεθος και αρκετή ενέργεια.

2. Πρέπει να έχουν ιδανικό περιβάλλον

3.Να έχει ολοκληρωθεί χρονικό διάστημα 20 λεπτών

4. Πρέπει να έχουν τον κατάλληλο ρυθμό ανάπτυξης

 

2. Το βακτήριο Thermus aquaticus από το οποίο λαμβάνουμε την Taq DNA πολυμεράση που εκτελεί την αντιγραφή στο PCR, δεν μπορεί:

1.Να καλλιεργηθεί σε στερεό θρεπτικό υλικό

2.Να καλλιεργηθεί σε υγρό θρεπτικό υλικό

3.Να συντηρηθεί στους -80οC

4.Να επωαστεί σε κλίβανο

3. Η βιοτεχνολογία:

1.Ανακαλύφθηκε από τον Ούγγρο K. Ereky

2.Ανακαλύφθηκε από τον Γάλλο L. Pauster

3.Αναπτύχθηκε σημαντικά μετά την ανάπτυξη της Γενετικής Μηχανικής

4.Αφορά αποκλειστικά τους μικροοργανισμούς

4.Η απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής πραγματοποιήθηκε σε συνθήκες:

1.Θερμοκρασία 37 βαθμοί Κελσίου, pH=7, αερόβια

2.Θερμοκρασία 25 βαθμοί Κελσίου, pH=5,5, αερόβια

3.Θερμοκρασία 37 βαθμοί Κελσίου , pH=5,5, αναερόβια

4.Θερμοκρασία -80 βαθμοί Κελσίου, pH=7, αναερόβια

5.Το βακτήριο E. coli διαιρείται κάθε 20’ σε μια καλλιέργεια, ο μέγιστος πληθυσμός είναι χ κύτταρα και μετά από 3 ώρες καλλιέργειας, ο πληθυσμός βρίσκεται στην εκθετική με χ/2 πλήθος κυττάρων, πόσο χρόνο χρειάζεται ακόμη η καλλιέργεια για να επιτύχει τον μέγιστο πληθυσμό;

1.Χ’

2.20’

3.3 ώρες

4.χ/2 ώρες

 

Ερωτήσεις σωστού- λάθους: μόρια 15

  1. Τα βακτήρια και οι μονοκύτταροι ευκαρυώτες διαιρούμενα πολλαπλασιάζονται.
  2. Όλοι ανεξαιρέτως οι μικροοργανισμοί χρειάζονται C, H, O, N, P, S.
  3. Η στερεή καλλιέργεια εμφανίζει λανθάνουσα εκθετική, στατική και φάση θανάτου.
  4. Η στερεή καλλιέργεια αποτελείται από αποικίες ενώ η υγρή αποτελείται από ανεξάρτητα αιωρούμενα κύτταρα.
  5. Όλοι οι μικροοργανισμοί χρειάζονται τα ίδια μίκρο και ιχνοστοιχεία σε διαφορετικές όμως συγκεντρώσεις, αναλόγως με την σύσταση και την λειτουργία των κυττάρων τους.
  6. Τα αυτότροφα μικρόβια απορροφούν ανόργανο C και τον μετατρέπουν σε οργανικές ενώσεις
  7. Οι αναερόβιοι μικροοργανισμοί δεν μπορούν να καλλιεργηθούν σε στέρεες καλλιέργειες.
  8. Τα αντιβιοτικά παράγονται κατά την στατική φάση από μη γενετικώς τροποποιημένα βακτήρια, κυρίως και χρησιμοποιούνται στην ιατρική για να σκοτώσουν άλλα μικρόβια.
  9. Σε μια συνεχή καλλιέργεια το περιβάλλον ανάπτυξης των μικροβίων στο βιοαντιδραστήρα είναι πάντα ιδανικό.
  10. Τα κύτταρα που εκτελούν ζύμωση, εκτελούν αναερόβιο μεταβολισμό, η ζύμωση όμως για μια καλλιέργεια μικροβίων είναι η υγρή ή η στερεή καλλιέργεια τους.
  11.  Όλα τα κύτταρα μιας μικροβιακής καλλιέργειας με χρόνο διπλασιασμού μια ώρα, που ξεκίνησε από ένα μοναδικό κύτταρο ως εμβόλιο, διαιρούνται συγχρόνως για όσο χρόνο διαρκεί η εκθετική φάση (οκτώ ώρες) .
  12. Ένας γενετικά τροποποιημένος μικροοργανισμός μπορεί να εκφράζει το ετερόλογο προιον τόσο στην εκθετική όσο και στην στατική φάση.
  13. Σε μια κλειστή καλλιέργεια η σιγμοειδής καμπύλη περιγραφή την κινητική των ζωντανών κυτταρων σε συνάρτηση με τον χρόνο.
  14. Κατά την παραγωγη του αντιβιοτικού από μια βιομηχανικής κλίμακας καλλιέργεια, τα κύτταρα εισάγονται στην στατική φάση και μετά στην φάση θανάτου από το εμπορικά παραγόμενο προιον της καλλιέργειας.
  15. Τα κύτταρα που παράγουν το αντιβιοτικό είναι γενετικά τροποποιημένα ώστε να παράγουν αυτό το προιον και πρέπει να φέρουν και γονίδιο ανθεκτικότητας σε αυτό .

Ζήτημα 2                                                                         μονάδες 25

1.Δίνεται το παρακάτω τρυβλίο με δύο διαφορετικές αποικίες του βακτηρίου D. Pneumoniae.

Διαγώνισμα Κεφ 7 blog-01

 

α. Ποια αποικία αφορά ποιο από τα δυο διαφορετικά στελέχη του υπό μελέτη βακτηρίου;

β. Εξηγήστε που οφείλεται αυτή η διαφορά των δυο στελεχών του ίδιου είδους μικροοργανισμών.

γ. Ποιο από τα δυο είδη θα είχε κατά την γνώμη σας μεγαλύτερα ποσοστά επιτυχίας κατά την   in vitro  διαδικασία μετασχηματισμού για την πρόσληψη πλασμιδιακού φορέα κλωνοποίησης;

δ. Εξηγήστε την απάντηση σας.                            μόρια (1,1,1,1,2) 5

2.Δίνονται παρακάτω τα βήματα που απαιτούνται για την εργαστηριακής κλίμακας στερεή καλλιέργεια ενός είδους μικροοργανισμού.

Τοποθετήστε τα στην σωστή σειρά.

  1. Επώαση σε κλίβανο
  2. παρασκευή κατάλληλου για τον μικροοργανισμό υγρού θρεπτικού υλικού
  3. απομόνωση μικροοργανισμών από το φυσικό του ενδιαίτημα
  4. εμβολιασμός του θρεπτικού υλικού
  5. διατήρηση της καλλιέργειας για μακρό χρονικό διάστημα στους -80 βαθμούς Κελσίου
  6. προσθήκη άγαρ
  7. ρύθμιση pH του θρεπτικού υλικού
  8. αποστείρωση του υλικού ανάπτυξης (μόρια 8)

3. Ποιες είναι οι συνθήκες που πρέπει να ελέγχονται για την ανάπτυξη μικροοργανισμών σε βιοαντιδραστήρες; (μόρια 4)

Για ποιο λόγο είναι απαραίτητη η διασφάλιση συνθηκών ασηψίας; (μόρια 3)

4. Ποια από τις παρακάτω καμπύλες δεικνύει την συνάρτηση N=f(t), όπου Ν ο πληθυσμός των μικροβιακών κυττάρων σε μια συνεχή καλλιέργεια  ; μόρια 1

Διαγώνισμα Κεφ 7 blog-02

 

Αιτιολογήστε την απάντησή σας. (μόρια 4)

 

Ζήτημα 3                                                                         μονάδες 25

Δίνεται το παρακάτω διάγραμμα dN/dt=f(t), το οποίο περιγράφει τη μεταβολή της ταχύτητας ανάπτυξης ενός μικροβιακού πληθυσμού σε συνάρτηση με τον χρόνο.

Διαγώνισμα Κεφ 7 blog-03

 

Εξηγήστε:

Αν η καλλιέργεια είναι υγρή ή στερεή, κλειστή ή συνεχής. (μόρια 6)

2. Δώστε μια εξήγηση γιατί ένα βακτήριο που φυσιολογικά απομονώνεται από το έδαφος στο επίπεδο της ριζόσφαιρας (θέση ανάπτυξης ριζών των φυτών, όπου υπάρχει περιορισμένη συγκέντρωση οξυγόνου), δεν μπορεί να αναπτυχθεί ικανοποιητικά στο εναέριο περιβάλλον. (μόρια 6)

3. Τα κύτταρα μιας αποικίας εκφράζουν όλα τα ίδια γονίδια;

Αιτιολογήστε την απάντηση σας. (μόρια 2 και 5)

4. Σε ένα μικροβιακό πληθυσμό που βρίσκεται στην εκθετική φάση μιας κλειστής καλλιέργειας όλα τα κύτταρα βρίσκονται σε αυτή τη φάση και κανένα δεν βρίσκεται σε διαφορετική φάση; Αιτιολογήστε την απάντηση σας.  (μόρια 2 και 4)

 

Ζήτημα 4                                                                         μονάδες 25

Στο παρακάτω γράφημα παρουσιάζεται η διακύμανση του πλήθους ενός βακτηριακού είδους. Για το είδος αυτό θέλουμε να μελετήσουμε την ανθεκτικότητα του σε δυο διαφορετικά αντιβιοτικά, την νεομυκίνη (Νeo) και την χλωραφαινικόλη (Chl), σε δυο διαφορετικές συγκεντρώσεις για το καθένα. Γνωρίζουμε ακόμη ότι το βακτηριακό αυτό είδος σε υψηλή θερμοκρασία θανατώνεται.

Διαγώνισμα Κεφ 7 blog-04

 

Το βακτηριακό είδος έχει τη δυνατότητα σε χαμηλές θερμοκρασίες, χαμηλότερες των 10 βαθμών Κελσίου να μειώνει στο ελάχιστο τον μεταβολισμό του.

Σημείωση: Η μελέτη της καλλιέργειας ξεκινάει από την χρονική στιγμή t  στο μέσο της εκθετικής φάσης για θερμοκρασία 37,5 βαθμών Κελσίου που είναι ιδανική για αυτό το μικροβιακό είδος.

t0 – θερμοκρασία 37,5 βαθμοί Κελσίου.

t1- θερμοκρασία 5 βαθμοί Κελσίου

t2- θερμοκρασία 28 βαθμοί Κελσίου

t3-10mg/mL Νεομυκίνη

t4-25mg/mL Νεομυκίνη

t5-0,1mg/mL Χλωραφαινικόλη

t6-0,5mg/mL Χλωραφαινικόλη

t7- θερμοκρασία 80 βαθμοί Κελσίου

  1. Εξηγήστε τις διάφορές στην κλίση της καμπύλης της εκθετικής φάσης για τα χρονικά διαστήματα t0 -> t1, t1->t2, t2->t3 και t7->t8
  2. Ποια είναι η ανθεκτικότητα του βακτηριακού είδους έναντι του αντιβιοτικού της νεομυκίνης;
  3. Για ποιο λόγο σε μοριακό επίπεδο κάποια από τα κύτταρα της βακτηριακής καλλιέργειας δεν επιζούν παρουσία 10mg/mL, αλλά κάποια άλλα κύτταρα επιζούν παρουσία 25mg/mL;
  4. Εξηγήστε την συμπεριφορά του βακτηριακού είδους έναντι του αντιβιοτικού της χλωραφαινικολής στις διαφορετικές δόσεις.
  5. Για ποιο λόγο το βακτηριακό είδος εμφανίζει διαφορετική συμπεριφορά έναντι των δυο αντιβιοτικών. (μόρια 20)

2.Δίνονται οι παρακάτω καμπύλες που παρουσιάζουν την συνάρτηση μεταβολής του πληθυσμού για το βακτήριο E. coli σε θερμοκρασία α. 36,6 και β. 39 βαθμοί Κελσίου, ενώ όλοι οι υπόλοιποι παράγοντες διατηρούνται σταθεροί και ιδανικοί για την ανάπτυξη του μικροβίου σε συνεχή καλλιέργεια. Εξηγήστε γιατί ο χρόνος διπλασιασμού της καλλιέργειας είναι αντιστρόφως ανάλογος του ρυθμού ανάπτυξης του. (μόρια 5)

Διαγώνισμα Κεφ 7 blog-05