Monthly Archives: Δεκέμβριος 2017

Διαγώνισμα κεφαλαίων 8 και 9 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

 

Επιλέξτε την ορθή επιλογή που συμπληρώνει σωστά την πρόταση:

  1. Στόχοι του προγράμματος του ανθρωπίνου γονιδιώματος είναι:

Α. Αλληλούχιση του γενετικού υλικού και χαρτογράφηση των γονιδίων μας.

Β. Ο προσδιορισμός των γονιδίων που σχετίζονται με τις ασθένειες

Γ. Η μελέτη της εξελικτικής μας πορείας

Δ. Η κατανόηση του ρόλου των περιοχών του γονιδιώματος μας, που δεν μεταγράφονται.

Ε. Όλα τα παραπάνω

  1. Οι απαραίτητες γνώσεις για την βιοτεχνολογική παραγωγή φαρμακευτικών πρωτεϊνών από βακτήρια, είναι:

Α. Γνώση του ιστού όπου εκφράζεται το υπεύθυνο γονίδιο, απομόνωση και κλωνοποίηση του γονιδίου, γνώση και δυνατότητα in vitro  των μετά μεταφραστικών τροποποιήσεων, οικονομικό όφελος.

Β. Χαρτογράφηση του υπεύθυνου γονιδίου, γνώση του ιστού που δρα η φαρμακευτική πρωτεΐνη, δημιουργία γονιδιωματικής βιβλιοθήκης, γνώση μετα-μεταγραφικών τροποποιήσεων in vitro.

Γ. Γνώση της αλληλουχίας του ανθρωπίνου γονιδιώματος, κατασκευή cDNA βιβλιοθήκης, οικονομικό όφελος.

Δ. Η καθολικότητα του κώδικα, η καθολικότητα των ριβοσωμάτων.

Ε. Τίποτα από τα παραπάνω.

  1. Πότε ξεκίνησε και πότε ολοκληρώθηκε το πρόγραμμα του ανθρωπίνου γονιδιώματος;

Α. Το 1986 και το 2005 αντιστοίχως

Β. Το 1990 >>>>>2001 >>>>>>>>

Γ. Το 1993 >>>>>2001 >>>>>>>>

Δ. Το 1990 >>>>>2005 >>>>>>>>

Ε. Τίποτα από τα παραπάνω.

  1. Με την δημιουργία του κλωνοποιημένου προβάτου Ντόλυ, αποδείχθηκε:

Α. Η δυνατότητα της αναπαραγωγής κλώνων ανθρώπων

Β. Ο επαναπρογραμματισμός μερικώς διαφοροποιημένων κυττάρων

Γ. Η κυτταρική διαφοροποιήση

Δ. Ότι και τα ζώα όπως και τα φυτά αναγεννιούνται από σωματικά κύτταρα.

Ε. Όλα τα παραπάνω

  1. Κατά την διαδικασία δημιουργίας διαγονιδιακών σολομών (ψάρια), πιο βήμα δεν θα πραγματοποιήθει:

Α. Η μικροέκχυση στο γονιμοποιημένο ωάριο

Β. Η in vitro γονιμοποίηση

Γ. Η τοποθέτηση του γονιμοποιημένου ωάριου στη μήτρα θετής μητέρας

Δ. Η απομόνωση σπερματοζωαρίων .

Ε. Όλα τα παραπάνω πρέπει να πραγματοποιηθούν.

Ζήτημα 2ο                                                              

Α. Ο Bob είναι ένας βελτιωμένος ταύρος γαλακτοπαραγωγής  προϊόν επιλεκτικών ομομεικτικών διασταυρώσεων και αποτελεί καθαρή σειρά. Η Bobena είναι αδελφή του Bob, με τα ίδια χαρακτηριστικά.

Επίσης, ο Sam  είναι ένας βελτιωμένος ταύρος κρεατοπαραγωγής και αυτός καθαρή σειρά. Τέλος η Samena είναι αδελφή του Sam, επίσης με τα ίδια χαρακτηριστικά όπως και ο Sam.

Οι γεωπόνοι ζωοτέχνες γενετιστές πραγματοποίησαν τις εξής διασταυρώσεις:

P1: Bob x Bobena

F1: θηλυκό Β1, αρσενικό Β2, αρσενικό Β3, θηλυκό Β4

P2: Sam x Samena

F1: αρσενικό S1, αρσενικό S2, θηλυκό S3, θηλυκό S4

P3: Bob x Samena

F1: θηλυκό BS1, θηλυκό BS2, αρσενικό BS3, αρσενικό BS4

P4: Sam x Bobena

F1: θηλυκό SB1, αρσενικό SB2, αρσενικό SB3, θηλυκό SB4

α. Ποια από τα παραπάνω άτομα έχουν μεταξύ τους τον ίδιο ακριβώς γονότυπο; (να λάβουμε υπόψη τον επιιχιασμό)

β. Ποια άτομα να αναμένεται να έχουν βελτιωμένες και τις δυο ιδιότητες (γαλακτοπαραγωγή και κρεατοπαραγωγή);

γ. Ποιοι απόγονοι αναμένεται να φέρουν στα κύτταρα τους τέσσερα ολόιδια μόρια DNA για το σύνολο των χρωμοσωμάτων τους;

δ. Ποια άτομα ονομάζονται υβρίδια;

ε. ποια άτομα παράγουν γαμέτες που είναι ολόιδιοι μεταξύ τους;

Β. Αναφέρεται τους λόγους που γνωρίζεται και είναι κατάλληλα τα ποντίκια ως πειραματόζωα.

Γ. ποιοι είναι οι στόχοι τις Ιατρικής και με ποιους τρόπους η σύγχρονη Βιοτεχνολογία τους επιτυγχάνει

Δ. Με δεδομένο ότι τα ποντίκια που θα χρησιμοποιηθούν για την παραγωγή μονοκλωνικών αντισωμάτων έναντι ενός επιλεγμένου αντιγόνου έρχονται για πρώτη φορά σε επαφή με το επιθυμητό αντιγόνο, μπορείτε να εξηγήσετε για ποιο λόγο παίρνουμε τον σπλήνα του ποντικού 15 ημέρες μετά τον εμβολιασμό του με το επιλεγμένο αντιγόνο;

Γνωρίζετε την καμπύλη της πρωτογενούς ανοσοβιολογικής απόκρισης των θηλαστικών, όπως δίνεται παρακάτω.

2017 Blog 8-9-02

Ζήτημα 3ο

Α. Σύμφωνα με την κρατούσα θεωρία για την ικανότητα του οργανισμού μας να παράγει μονάχα τα αντισώματα που αναγνωρίζουν αντιγονικούς καθοριστές (πρωτεΐνες, γλύκοπρωτεΐνες κ.α.) που ανήκουν σε ξένες προς τον οργανισμό ουσίες/σώματα, κατά την εμβρυακή ηλικία μας δοκιμάζονται τα πιθανά αντισώματα που μπορεί να φτιάξει ο οργανισμός επί των αντιγονικών καθοριστών του ίδιου του οργανισμού και καταστρέφονται τα πιθανά λεμφοκύτταρα που αναγνωρίζουν τους αντιγονικούς καθοριστές του οργανισμού μας.

Σύμφωνα με τα παραπάνω μπορείτε να εξηγήσετε για ποιο λόγο ενώ κατά την γονιδιακή θεραπεία της κυστικής ίνωσης το φυσιολογικό αλληλόμορφο ενθέθηκε επιτυχημένα στο γονιδίωμα των κυττάρων στόχων του ασθενούς και εκφράστηκε επίσης επιτυχημένα εντούτοις ο ασθενής δεν θεραπεύτηκε από την ασθένεια;

Β. δίνεται το παρακάτω γενεαλογικό δένδρο, το οποίο αφορά την γενεαλογία των πρόβατων που χρησιμοποιούνται ως πειραματόζωα σε ένα ερευνητικό εργαστήριο γενετικής βελτίωσης ζωών.

2017 Blog 8-9-03

Από το πρώτο ζευγάρι Ι1 και Ι2 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την ανθρώπινη ινσουλίνη, ενώ από το ζευγάρι Ι3 και Ι4 επιδιώχθηκε η δημιουργία διαγονιδιακών ζωών που παράγουν στο γάλα τους την α1 αντιθρυψίνη του ανθρώπου.

Γνωρίζουμε ότι  το ανθρώπινο γονίδιο της ινσουλίνης έχει μέγεθος 2000 ζεύγη βάσεων  ενώ της α1-αντιθρυψίνης έχει μέγεθος 4000 ζεύγη βάσεων

Παρακάτω δίνονται τα αποτελέσματα των μοριακών εξετάσεων με PCR που πραγματοποιήθηκαν στα ζώα της ΙΙΙ γενεάς.

2017 Blog 8-9-04

Σύμφωνα με τα παραπάνω δεδομένα:

α. Ποια από τα άτομα της ΙΙ γενεάς είναι ή μπορεί να είναι διαγονιδιακά;

β. Ποιο από τα άτομα της ΙΙΙ γενεάς δημιουργήθηκε με όμοια τεχνολογία όπως και η Dolly και ποιο είναι κλώνος στο σύνολο του γενετικού του υλικού με το ζώο από το οποίο προήλθε;

Να αξιολογήστε την απάντηση σας.

Γ. Σε ένα άτομο διαπιστώθηκε με τα από βιοχημικές εξετάσεις η παραγωγή ινσουλίνης στο ήπαρ και όχι στο πάγκρεας, δώστε μια ερμηνεία γι΄αυτή την παρατήρηση. Ποιες περαιτέρω εξετάσεις έπρεπε να γίνουν για να γίνει δυνατή η ερμηνεία;

Ζήτημα 4ο

Σε ένα ερευνητικό ίδρυμα Γεωπονικών Εφαρμογών, οι Γεωπόνοι Βιοτεχνολόγοι, επιδιώκουν την γενετική τροποποίηση της Ελιάς με γονίδιο ενός είδους ιχθύος για την παραγωγή ελαιόλαδου εμπλουτισμένου με ω-3 λιπαρά οξέα.

Οι επιστήμονες διαθέτουν τα εξής: Τα παρακάτω καθώς και όλα τα ένζυμα της τεχνολογίας του ανασυνδυασμένου DNA  που γνωρίζετε από το σχολικό βιβλίο καθώς και όλα τα υλικά και τον τεχνικό εξοπλισμό που απαιτείται.

2017 Blog 8-9-05

Περιοριστικά έζυμα και θέσεις αναγνώρισης τους (δίνεται μόνο ο ένας από τους δυο συμπληρωματικούς κλώνους):

BamHI 5’ G/GATCC3’
HindIII 5’ AGG/CCT3’
XmaI 5’A/AGCTT3’
PstI 5’CTGCA/G3’
KpnI 5’GGTAC/C3’
SalI 5’G/TCGAC3’
XhoI 5’C/TCGAG3’

Υπόμνημα:

Υ1: Υποκινητής ενός γονιδίου που εκφράζεται στον ελαιόκαρπο.

Υ2: Υποκινητής ενός γονιδίου που εκφράζεται στον ελαιόκαρπο και στον κορμό του δένδρου.

Υ3: Υποκινητής του επιθυμητού γονιδίου του ψαριού

Υ4: Υποκινητής του Τi πλασμιδίου που εκφράζεται στα έμβρυα Ελιάς  μέχρι το στάδιο των 16 κυττάρων.

Τ- DNA : Τμήμα του Τi πλασμιδίου που ενθέτεται στο φυτικό γονιδίωμα.

Οι επιστήμονες θέλουν το ετερόλογο γονίδιο να εκφράζεται μόνο στους ελαιόκαρπους.

Το γονίδιο του ψαριού φέρει εκατέρωθεν του πλαισίου ανάγνωσης θέσεις KpnI. Καμία άλλη θέση αναγνώρισης από τις παραπάνω δεν υπάρχει στο γονίδιο αυτό.

Α. ποια περιοριστική ενδονουκλεάση θα χρησιμοποιήσουν οι επιστήμονες για να πέψουν το πλασμίδιο που δίνεται; Αιτιολογήστε την απάντηση σας.

Β. Πως θα πραγματοποιηθεί  η διάκριση των γενετικά τροποιημένων φυτών από τα μη τροποποιημένα ; αιτιολογήστε την απάντηση σας.

Γ. στο εργαστήριο είναι διαθέσιμο και ένα άλλο Τi πλασμίδιο, είναι αυτό το πλασμίδιο κατάλληλο για την γενετική τροποποίηση της Ελιάς;

2017 Blog 8-9-06

Υπόμνημα:

Υ1: Υποκινητής ενός γονίδιου που εκφράζεται αποκλειστικά στον ελαιόκαρπο.

Υ2: Υποκινητής ενός γονιδίου ογκογενετικού του πλασμιδίου Τi.

Υ3: Υποκινητής καθολικός φυτικός της Ελιάς.

Υ4: Υποκινητής του γονιδίου ανθεκτικότητας στο αντιβιοτικό τετρακυκλίνη.

Δ. Μετά από την επιτυχημένη δοκιμασία γενετικής τροποποίησης της Ελιάς. Οι επιστήμονες θέλουν να δημιουργήσουν φυτά ομόζυγα για το ετερόλογο γονίδιο αυτό. Πώς μπορούν να το επιτύχουν αυτό;

Advertisements

Διαγώνισμα Βιολογίας θετικής Κατευθύνσης κεφαλαίου 4 – Τεχνολογία ανασυνδυασμένου DNA

Ζήτημα 1.                                                                                                                           Μονάδες 25

  1. Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BamHI είναι:

5′ G|GATCC 3′

3′ CCTAG|G 5′

Η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης BclI είναι:

 5′ T|GATCA 3′

 3′ ACTAG|T 5′

Ένα γραμμικό μόριο DNA διαθέτει μοναδική θέση αναγνώρισης BamHI και ένα άλλο μόριο επίσης γραμμικό, με την ίδια κατά τα άλλα, ακριβώς αλληλουχία διαθέτει μοναδική θέση BclI, στη θέση της BamHI. Τα δυο μόρια πέπτονται ανεξάρτητα το ένα από το άλλο με την κατάλληλη περιοριστική ενδονουκλεάση το καθένα. Τα προϊόντα της πέψης αναμιγνύονται και προστίθεται το ένζυμο DNA δεσμάση. Στο τελικό μείγμα προστίθονται και οι δυο περιοριστικές ενδονουκλεάσες BamHI και BclI.

 Δημιουργούνται:

α. 4 διαφορετικά μόρια DNA

β. 2 διαφορετικά μόρια DNA

γ.1 μόριο DNA

δ. 2 όμοια μόρια DNA

 2. Στο παραπάνω μείγμα:

α. δρουν και οι δυο περιοριστικές ενδονουκλεάσες πάντα

β. δρα μόνο η μια από τις δυο περιοριστικές ενδονουκλεάσες πάντα

γ. μπορεί να δράσει ή η μια ή άλλη περιοριστική ενδονουκλεάση

δ. μπορεί να μην δράσει καμιά από τις δυο περιοριστικές ενδονουκλεάσες.

 3. Ποια από τις παρακάτω αλληλουχίες αποτελεί πιθανή θέση αναγνώρισης κάποιας περιοριστικής ενδονουκλεάσης;

α. 5’A|CTGC3′

3’TGAC|G5′

β. 5′ T|TTAAA3′

3’AAATT|T5′

γ. 5′ G|GATCA3′

3′ CCTAG|T5′

δ. 5’G|AATTC3′

 4. Μπορούμε να δημιουργήσουμε cDNA βιβλιοθήκη:

α. Για το γονίδιο της EcoRI, β. Για το γονίδιο του tRNA της Aργινίνης των λευκοκυττάρων μας

γ. Για το οπερόνιο της λακτόζης, δ. Για το γονίδιο της αντίστροφης μεταγραφάσης του HIV.

 5. Ένας φορέας κλωνοποίησης διαθέτει εκτός από το γονίδιο ανθεκτικότητας στην καναμυκίνη (αντιβιοτικό) και το γονίδιο LeuI που κωδικοποιεί το ένζυμο το οποίο απαιτείται για την σύνθεση του αμινοξέα Λεύκινη και μπορεί να χρησιμοποιηθεί ως γονίδιο για την επιλογή των μετασχηματισμένων ξενιστών με το ανασυνδυασμένο πλασμίδιο.

Ποιο γονότυπο και ποιο φαινότυπο πρέπει να εμφανίζουν τα επιθυμητά κύτταρα ξενιστές;

α. Πριν το μετασχηματισμό ήταν LeuI- και μετά τον μετασχηματισμό αυξάνονται σε περιβάλλον δίχως Λεύκινη.

β. Πριν το μετασχηματισμό ήταν LeuI+ και μετά το μετασχηματισμό δεν αυξάνεται σε περιβάλλον δίχως Λεύκινη

γ. Μετά το μετασχηματισμό ήταν LeuI- και αυξάνεται σε περιβάλλον δίχως Λεύκινη

δ. Μετά το μετασχηματισμό ήταν LeuI+ και δεν αυξάνεται σε περιβάλλον δίχως Λευκινη

 Ζήτημα 2                                                                                                                            Μονάδες 25

  1. Διαθέτετε το γονίδιο Ψ2 και θέλετε να το ενθέσετε εντός του φορέα κλωνοποίησης Β2 οποίος διαθέτει τις εξής θέσεις περιορισμού (οι αλληλουχίες είναι δίκλωνες αλλά δίνονται μόνο ο ένας από τους δυο κλώνους).

StuI : 5′ AGG|CCT3′                                                                                           SalI: G|TCGAC3′

Ψ2:5′ TCCGGCGGAATTCCAAGGCCT[ΑΤG…κωδική περιοχή]CGTCGACTCCGGC 3′

       3′ AGGCCGCCTTAAGGTTCCGGA[TAC…κωδική περιοχή]GCAGCTGAGGCCG 5′

 Τμήμα του Β2 _________Διεύθυνσης μεταγραφής_>____StuI_____SalI____EcoRI__________͢

α. Υπάρχουν δυο διαφορετικοί τρόποι ένθεσης του γονιδίου Ψ2 (κωδική περιοχή του) στο πλασμίδιο Β2. Ποιο είναι αυτοί; Ποιο περιοριστικό ένζυμο θα χρησιμοποιήσετε  για να πεψετε το πλασμίδιο και το γονίδιο ώστε να απομονώσετε μόνο την κωδική περιοχή του γονιδίου;                                                                                                                                             Μοναδες 10

β. Ποιος από τους δυο αυτούς τρόπους είναι ο κατάλληλος για να είναι δυνατή η έκφραση του γονιδίου Ψ2 στο κύτταρο ξενιστή (μονάδες 5); Αιτιολογήστε την απάντηση σας.                                                                                                                                                  Μονάδες 10

 Ζήτημα 3                                                                                                                            Μονάδες 25

  1. Εξηγήστε πως θα μπορούσαμε να παράξουμε την αιμοσφαιρίνη Α, που αποτελείται από 2 α και 2 β πολυπεπτιδικές αλυσίδες , από βακτήρια με την τεχνολογία της cDNA βιβλιοθήκης.
  2. Δίνεται το παρακάτω υποθετικό γονίδιο του λ φάγου που κωδικοποιεί για ένα ολιγοπεπτιδιο. Το γονίδιο αυτό θέλουμε να το κλωνοποιησουμε με σκοπό την παραγωγή του ολιγοπεπτιδίου που κωδικοποιεί σε ζυμομύκητα.

…_________________________________________________________________…

ΥATTGCGGAATTCAAATGCCCAGTTCATGTAGAATTCTAAGCGC

 

            YTAACGCCTTAAGTTTACGGGTCAAGTACATCTTAAGATTCGCG

…_________________________________________________________________…

Για την κλωνοποιήση του συγκεκριμένου γονίδιου θα επιλέξετε μεταξύ των παρακάτω φορέων κλωνοποιήσης.

2017 inmid-01Σημείωση:Η θέση περιορισμού δίπλα στον υποκινητή τόσο του ενός όσο και του άλλου πλασμιδιου είναι η θέση αναγνώρισης της περιοριστικής ενδονουκλεασης EcoRI.

Στο πλασμίδιο 1 ο εσωτερικός μητρικός κλώνος όταν αντιγράφεται στη διχάλα που εξελίσσεται προς τα αριστερά ο νεοσυντιθέμενος συμπληρωματικός κλώνος συντίθεται συνεχώς. Στο πλασμίδιο 2 ο αντίστοιχος μητρικός κλώνος στη διχάλα που εξελίσσεται προς τα δεξιά ο νεοσυντιθέμενος συμπληρωματικός κλώνος συντίθεται συνεχώς.

Α. Ποια είναι κωδική και ποια μη κωδική αλυσίδα του γονιδίου του λ-φάγου;

Β. Ποιο ολιγοπεπτίδιο κωδικοποιεί αυτό το γονίδιο;

Γ. Ποιο από τα πλασμιδια θα χρησιμοποιήσετε για την κλωνοποιήση του γονιδίου και αιτιολογήστε την απάντηση σας.

Δ. Μετά την επιτυχή έκφραση του γονιδίου στα κύτταρα ξενιστές απομονώθηκαν δυο διαφορετικά ολιγοπεπτίδια που παράγονται από τα μετασχηματισμένα κύτταρα ζυμών με τα ανασυνδυασμενα πλασμιδια. Τα δυο αυτά ολιγοπεπτιδια παράγονται από διαφορετικά μετασχηματισμένα μυκητιακα κύτταρα. Δηλαδή το ίδιο κύτταρο δεν παράγει και τα δυο ολιγοπεπτιδια. Και τα δυο είναι προϊόντα έκφρασης του ετερολογου γονιδίου που ανασυνδυάστηκε με τον φορέα κλωνοποιήσης.

Εξηγήστε το φαινόμενο.

Ε. Είναι δυνατόν το κύτταρο ζύμης ξενιστής να παράγει το λειτουργικό ολιγοπεπιδιο του λ-φαγου δεδομένου ότι ο λ-φαγος προσβάλει βακτηρία;

 

Ζήτημα 4                                                                                                                            Μοναδες 25

Δίνεται η παρακάτω αλληλουχία του γονιδίου Φ1 (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) που κωδικοποιεί για το ένζυμο του βακτηρίου Lactobacillus arabinosus που σχηματίζει την βιταμίνη Β9 (φολικό οξύ).

Από την γονιδιωματική βιβλιοθήκη του βακτηρίου απομονώθηκε το γονίδιο Φ1 με στόχο την εισαγωγή του σε κατάλληλο φορέα κλωνοποίησης που θα μετασχηματίσει κύτταρα ζυμών αρτοποιίας ώστε να εμπλουτίζεται το ψωμί με φολικό οξύ.

Στο δοθέν γονίδιο δεν περιλαμβάνεται η αλληλουχία του υποκινητή του. Υποδεικνύονται τα κωδικόνια έναρξης και λήξης του Φ1 και εντός των 1500 ζ. β. που παρεμβάλλονται μεταξύ των κωδικονίων έναρξης και λήξης δεν υπάρχουν θέσεις αναγνώρισης των περιοριστικών ενζύμων: XbaI (5′TCTAGA3′ ), SacI (5′GAGCTC3′ ), BamHI (5′GGATCC3′), BglIi(5′AGATCT3′), NdeI(.5′CATATG 3′ )

5′ GTCTAGAAGAGCTCCTTGGATCCAAAGATCTACCATATGTCTCGCCTA   1500 συνέχεια γονίδια

5’GTCTAGAAGAGCTCTGGATCCAAGATCTACCATATGTAAGCG3′

Δίνεται επίσης ο φορέας κλωνοποίησης που θα χρησιμοποιηθεί για την κλωνοποίηση του γονιδίου Φ1 στη ζύμη αρτοποιίας. Δίνεται ακόμη η αλληλουχία του φορέα κλωνοποίησης (εδώ εμφανίζεται μονόκλωνη ενώ είναι δίκλωνη) από τη θέση BglI μέχρι τη θέση SacI, όπου περιλαμβάνεται και ο υποκινητής που θα είναι υπεύθυνος για τη μεταγραφή του γονιδίου Φ1.

Τμήμα του φορέα κλωνοποίησης:

__________Διεύθυνση μεταγραφής>___XbaI__NdeI___BamHI___SacI_____________________

Υποκινητής

———————->

5′AGATCTCGATCCCCCGAAATTAATACGACTCACTATACGGGAATTGTCACCGCATAACAATTCCCCTCTAGAAATAATT

5΄TTGTTTAACTTTAAGAAGGAGATATACATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCGAA

MetAlaSerMetThrGlyGlyGlnGlnMetGlyArgGlySerGlu

5’TCGAGCTCCGTCGAC3′

LeuArgArgGlnAla

α. Για την έκφραση του γονιδίου Φ1 στη ζύμη, ποιες πρωτεΐνες και από ποιον οργανισμό θα πρέπει να συνδεθούν με τον υποκινητή του φορέα κλωνοποίησης που θα χρησιμοποιηθεί;

Μονάδες 8

β. Αν υποθέσουμε ότι τα επιπλέον αμινοξέα στο αμινοτελικό άκρο της πρωτεΐνης που κωδικοποιείται από το Φ1 γονίδιο δεν επηρεάζουν την λειτουργικότητα της απαντήστε στις παρακάτω ερωτήσεις:

  1. I) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με πέψη με BamHI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικέ με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

ΙΙ) Εάν δημιουργούσατε τον ανασυνδυασμένο φορέα κλωνοποίησης με με πέψη με το ένζυμο SacI:

ι) Περιμένετε το κύτταρο ζύμης που μετασχηματιστικέ με τον ανασυνδυασμένο φορέα κλωνοποίησης να δημιουργεί μόριο mRNA από το γονίδιο Φ1;

ιι) Το μετασχηματισμένο κύτταρο ζύμης θα συνθέτει λειτουργική πρωτεΐνη που κωδικοποιείται από το γονίδιο Φ1;

Μονάδες  4Χ4=16