Monthly Archives: Οκτώβριος 2017

Επαναληπτικό Διαγώνισμα Βιολογίας Θετικού Προσανατολισμού κεφαλαίων 1,2,4 &7

Ζήτημα 1.

Α. Επιλέξτε την ορθή απάντηση:

  1. κατά την μεταγραφη των γονιδιων του οπερονιου της λακτοζης δημιουργουνται…………………. mRNA

Α. 1, β. 2, γ. 3, δ.4                                                                     (5 μονάδες)

  1. Από τα ………διαφορετικα κωδικονια , …………κωδικοποιουν αμινοξεα και ………οδηγουν στον τερματισμο της πρωτεινοσυνθεσης.

Α. 180, 20, 4 β. 20, 17, 3 γ. 20, 17, 4, δ. 64, 61, 3                                     (5 μοναδες)

  1. Σωστο – Λαθος:

Α. Για να κατασκευστει μια cDNA βιβλιοθηκη απομονωνεται το ολικο mRNA από κυτταρα που εκφραζουν το γονιδιο που θελουμε να μελετησουμε.

Β. Η μεταβολή του πληθυσμού σε συνάρτηση με τον χρόνο μιας συνεχούς καλλιέργειας φυσιολογικών κυττάρων E.coli, εμφανίζει καμπύλη διαύξησης.

Γ. Στην αντιγραφή του βακτηριακου DNA συμμετέχουν 2 DNA πολυμερασες.

Δ. Ένα φυσιολογικο ανθρωπινο σωματικο κυτταρο εχει στον πυρηνα του 24* 10 9 βασεις κατά την μεταφαση της μιτωσης του.

Ε. κατά την πεψη ενός κυκλικου μοριου DNA από την EcoRI σπαζουν περισσοτεροι φωσφοδιεστερικοι δεσμοι από ότι ενός γραμμικου μοριου DNA.

Δινεται ότι το κάθε μοριο διαθετει 4 θεσεις αναγνωρισης της EcoRI.                (15 μοναδες)

Ζητημα 2

Α. Γιατι τα κυτταρα ενός πολυκυτταρου οργανισμου, παροτι εχουν όλα τα ιδια γονιδια  διαφερουν στην μορφη και την λειτουργια τους; (5 μοναδες)

Β. Ένα διπλοειδες κυτταρο υφισταται μιτωση και στη συνεχεια  τα θυγατρικα κυτταρα υφιστανται μειωση.

Σχεδιαστε ένα κοινο διαγραμμα οπου θα φαινονται οι μεταβολες της ποσοτητας του γενετικου υλικου του ενός κυτταρου σε σχεση με το χρονο. Αιτιολογηστε την απαντηση σας.

Δινεται ότι το γενετικο υλικο του πυρηνα του κυτταρου, κατά την μεταφαση της μιτωσης του, εχει μηκος 4* 10 8 ζευγη βασεων. (10 μοναδες)

Γ. Στο παρακατω σχημα φαινεται η διχαλα αντιγραφης ενός πλασμιδιου. Αφου μεταφερετε το σχημα στο τετραδιο σας, συμπληρωστε τον προσανατολισμο των αλυσιδων στα ακρα της διχαλας, καθως και τον προσανατολισμο της αντιγραφης σε κάθε αλυσιδα. Τελος, να χαρακτηρισετε τον τροπο συνθεσης των νεων αλυσιδων του DNA.

2017 Επαναλληπτικό 1 2 4 7-01

Αιτιολογηστε συντομα την απαντηση σας.  (2+2+2+4 = 10 μοναδες)

Ζητημα 3

Μια συνεχης καλλιεργεια βακτηριων E. coli περιεχει εξαρχης δυο στελεχη βακτηριων. Τα βακτηρια που ανηκουν στο ένα στελεχος διαθετουν ένα πλασμιδιο το οποιο περιεχει ένα γονιδιο ανθεκτηκοτητας στο αντιβιοτικο καναμυκινη. Τα βακτηρια που ανηκουν στο άλλο στελεχος διαθετουν ένα διαφορετικο πλασμιδιο που φερει ένα διαφορετικο γονιδιο ανθεκτικοτητας στην καναμυκινη ( το οποιο κωδικοποιει την ιδια πρωτεινη με το γονιδιο ανθεκτικοτητας του πρωτου πλαδμιδιου), και ένα γονιδιο ανθεκτικοτητας στην πενικιλινη.

Τα βακτηρια  της καλλιεργειας αναπτυσονται σε ζυμωτηρα στον οποιο προσθετουμε την χρονικη στιγμη τ1 χ ποσοτητα καναμυκινης, την στιγμη τ2 y/2 ποσοτητα πενικιλινης και την στιγμη τ3 y ποσοτητα πενικιλινης.

Το ακολουθο διαγραμμα δειχνει τις μεταβολες στον πληθυσμο των μικροοργανισμων σε σχεση με τον χρονο.

2017 Επαναλληπτικό 1 2 4 7-02

Α. Να εξηγησετε γιατι, παροτι και τα δυο στελεχη διαθετουν ένα γονιδιο ανθεκτικοτητας στην καναμυκινη, μετα την προσθηκη του αντιβιοτικου στο θρεπτικο υλικο την χρονικη στιγμη τ1, παρουσιαζεται μερικη μειωση του πληθυσμου των βακτηριων. (5 μοναδες)

Β. Να χαρακτηρισετε κάθε φαση της καλλιεργειας όπως εμφανιζεται στο διαγραμμα και να αιτιολογησετε την απαντηση σας. (5 μοναδες)

Γ. Να εξηγησετε γιατι τα βακτηρια της καλλιεργειας «αντιδρουν» διαφορετικα αναμεσα στις δυο περιπτωσεις προσθηκης πενικιλινης.(5 μοναδες)

Δ. Σε μια νεα δημιουργια της καλλιεργειας, προσθετουμε μικροτερες ποσοτητες καναμυκινης και πενικιλινης σε σχεση με τις αρχικες. Πιστευετε ότι αυτό θα επηρεασει τον ρυθμο αναπτυξης των βακτηριων της καλλιεργειας; Να αιτιολογησετε την απαντηση σας. Σχεδιαστε το νέο πιθανο διαγραμμα του ρυθμου αναπτυξης των βακτηριων συμφωνα με την απαντηση σας. Υποθεστε ότι οι προσθηκες των αντιβιοτικων εγιναν στις ιδιες αντιστοιχες στιγμες όπως φαινονται στο διαγραμμα που σας δοθηκε. (2+3+5=10)

Ζητημα 4

Τρια δειγματα πλασμιδιακου DNA πεπτονται με διαφορες περιοριστικες ενδονουκλεασες και στη συνεχεια αναλυονται σε πηκτωμα αγαροζης. Τα αποτελεσματα είναι αυτά που φαινονται στις εικονες. Γνωριζετε ότι κανενα πλασμιδιο δεν εχει δυο ιδιες θεσεις αναγνωρισης. Επισης είναι γνωστο ότι το πλασμιδιο 1  εχει μηκος 20.000 ζευγη βασεων, το πλασμιδιο 2 εχει μηκος 15.000 ζευγη βασεων  και το πλασμιδιο 3 εχει μηκος 10.000 ζευγη βασεων.

2017 Επαναλληπτικό 1 2 4 7-03

2017 Επαναλληπτικό 1 2 4 7-04

Σημείωση: Στο τρίτο πηκτωμα αγαροζης με την σειρά  που δίνονται στο πρώτο πλασμιδιο η ζώνη στις 10.000 ζεύγη νουκλεοτιδιων είναι διπλάσια σε πάχος από όλες τις υπολοίπων των τεσσάρων πηκτωματων αγαροζης.

Α. Σχεδιαστε τον περιοριστικο χαρτη καθε πλασμιδιου (για το πλασμιδιο 1 αρκει μια εκδοχη). Δεν απαιτηται αιτιολογηση. (6 μοναδες).

Β. Δινεται η αλληλουχια ενός  υποθετικου γονιδιου του πλασμιδιου 2 που κωδικοποιει τη συνθεση μιας πρωτεινης.

Αλυσιδα1. …TCGACGGGTACGCTATGCGCCGTTTTGTAAAAACGAGGACTTTG…

Αλυσιδα 2….ΑGCTGCCCATGCGATACGCGGCAAAACATTTTTGCTCCTGAAAC…

Η υπογραμμιση δηλωνει την 5΄αμεταφραστη περιοχη .

  1. ποια αλυσιδα είναι η κωδικη και ποια η μη κωδικη και σημειωστε τα 5΄και 3΄ακρα της κάθε αλυσιδας. Αιτιολογηστε την απαντηση σας. (μοναδες 5).
  2. Ο υποκινητης του παραπανω γονιδιου αποτελειται από 120 βασεις. Από αυτές, το 15% είναι αδενινες. Να βρειτε τα ποσοστα και τους αριθμους των υπολοιπων. (μοναδες 3).

Γ. Δινεται το ακολουθο γονιδιο το οποιο κωδικοποιει τη συνθεση μιας πρωτεινης του ανθρωπου:

5’ AGCGAATTCGCTCTGCAG…GGATCC…GCTAT…ATG…GAATTC…TAGCTGCAG…GGATCC3’

3’ TCGCTTAAGCGAGACGTC…CCTAGG…CGATA…TAC…CTTAAG…ATCGACGTC…CCTAGG5’

3’ ΑΜΕΤΑΦΡΑΣΤΗ ΑΛΜ

Οπου ΑΛΜ= Αλληλουχιες ληξης της Μεταγραφης. Οι ΑΛΜ βρισκονται στις αλληλουχίες που ακολουθουν αμεσως μετα την 3′ αμεταφραστη περιοχη του δοθεντος γονιδιου. Η αλληλουχία του υποκινητή είναι η υπογραμμισμένη στα αριστερά αλληλουχία του γονιδίου που δίνεται.

Να προσδιορισετε ποια/ποιες περιοριστικη/ες ενδονουκλεαση/ες μπορει/ουν να χρησιμοποιηθει/ουν για την πεψη του γονιδιου, ώστε στη συνεχεια να ενθεθει ακεραιο σε καποιο από τα πλασμιδια του προηγούμενου ερωτήματος και να μπορει να εκφραζεται επιτυχως. Να αιτιολογηθει η απαντηση σας.

Δ. Να προσδιορισετε ποιο/α πλασμιδιο/α θα μπορουσε/αν να χρησιμοποιηθει/ουν ως φορεας/εις κλωνοποιησης για το γονιδιο του προηγουμενου ερωτηματος, με βαση την απαντηση σας στο προηγουμενο ερωτημα. Να εξηγησετε επισης ποιες άλλες προυποθεσεις θα πρεπει να πληροι/ουν αυτό/α το/τα πλασμιδιο/α ώστε να μπορει να χρησιμοποιηθει επιτυχως ως φορεας κλωνοποιησης.

(μοναδες 2+4=6)

Δίνονται:

Θέση αναγνώρισης της PstI……………… Θέση αναγνώρισης της BamHI

5’ CTGCAG3’…………………………………………………………5’GGATCC3’

3’ GACGTC5’ …………………………………………………………3’CCTAGG5’

 

Δημιουργημένο απο την α’ φοιτήτρια της Ιατρικής Κωνσταντίνα Ραουζαίου

Advertisements

‘Υλη Βιολογίας Ομάδας Θετικού Προσανατολισμού, ποια είναι άραγε;

ΝΙΚΟΛΕΤΤΑ ΜΑΡΓΑΡΙΤΗ

Με αφορμή το ΦΕΚ 2893/2017 αρ. 134932/Δ2 σχετικά με την εξεταστέα ύλη, για τις εξετάσεις εισαγωγής στην Τριτοβάθμια Εκπαίδευση, του μαθήματος της Βιολογίας Θετικού Προσανατολισμού, από το οριζόμενο στο παραπάνω ΦΕΚ σχολικό εγχειρίδιο για το μάθημα αυτό.

Πιο συγκεκριμένα εντός εξεταστέας ύλης είναι;

Α) Ολόκληρο το κείμενο για τα κεφάλαια 1,2,4,5,6 και 9 ενώ για τα κεφάλαια 8 και 7 είναι το σύνολο του κειμένου των δύο αυτών κεφαλαίων με εξαίρεση τις εκτός εξεταστέας ύλης παραγράφους τους (μία για το 7ο κεφάλαιο «Η παραγωγή της Πενικιλίνης αποτελεί σημαντικό σταθμό στην πορεία της Βιοτεχνολογίας» και δύο για το 8ο κεφάλαιο «Εμβόλια, αντιβιοτικά»).

Β) Εντός εξεταστέας ύλης είναι όλες οι εικόνες του κάθε κεφαλαίου, με εξαίρεση όσες αφορούν τις εκτός ύλης παραγράφους των κεφαλαίων 7 και 8, ανεξαρτήτως του χρωματικού πλαισίου που περιβάλλει την κάθε εικόνα. Ενώ εντός ύλης προς εξέταση είναι και οι λεζάντες των εικόνων των παραπάνω κεφαλαίων. Όταν οι εικόνες παρουσιάζουν χημικούς τύπους τότε δεν απαιτείται η απομνημόνευση αυτών.

Γ) Είναι εντός εξεταστέας ύλης τα τμήματα του καθενός από τα παραπάνω κεφάλαια με τίτλο «Ταξίδι στο χρόνο».

Δ) Είναι εντός εξεταστέας ύλης η περίληψη που υπάρχει στο τέλος καθενός από τα παραπάνω κεφάλαια.

Ε) Είναι εντός εξεταστέας ύλης, οι εργασίες – δραστηριότητες σε οποιοδήποτε από τα παραπάνω κεφάλαια.

ΣΤ) Είναι εντός ύλης οι πίνακες που υπάρχουν σε καθένα από τα παραπάνω κεφάλαια.

Ζ) Είναι εντός εξεταστέας ύλης, οι ερωτήσεις στο τέλος κάθε κεφαλαίου.

Η) Είναι εντός εξεταστέας ύλης, τα τμήματα των παραπάνω κεφαλαίων με τίτλο «σκεφτείτε» σε οποιοδήποτε από τα κεφάλαια αυτά υπάρχουν τέτοια τμήματα.

Θ) Τέλος, ποιες από τις γνώσεις που έχουν αποκτήσει οι υποψήφιοι από τις προηγούμενες τάξεις της γυμνασιακής και λυκειακής τους εκπαίδευσης στο μάθημα της Βιολογίας και οι οποίες δεν αναφέρονται στο βιβλίο της Γ’ Λυκείου, όπως αυτό αναφέρεται στο παραπάνω ΦΕΚ, είναι δυνατόν να τους ζητηθούν άμεσα ή έμμεσα; (Εδώ νοούνται προϋπάρχουσες γνώσεις, οι οποίες είναι απαραίτητες για να γίνει κατανοητό ένα τμήμα ή μία έννοια στο βιβλίο της Γ’ Λυκείου, η οποία δεν αναλύεται επαρκώς στο βιβλίο της Γ΄ Λυκείου καθώς θεωρείται γνωστή από προηγούμενες τάξεις.)

Προκείμενου να γίνει ποιο σαφές το ερώτημα μου, θα φέρω το παράδειγμα (υπάρχουν πολλά παραδείγματα, άλλα επιλέγεται ένα πρόσφατο) των θεμάτων των εισαγωγικών εξετάσεων των ημερησίων λυκείων του 2016, όπου τέθηκε το παρακάτω ερώτημα πολλαπλής επιλογής:

«Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9 του σχολικού βιβλίου της Γ΄ Λυκείου, τη διαδικασία κλωνοποίησης, τον ορισμό και τη δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 του σχολικού βιβλίου της Γ΄ Λυκείου, ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 του σχολικού βιβλίου της Γ΄ Λυκείου, τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει τη θέση των μιτοχονδρίων στα κύτταρα (ότι δηλαδή αυτά δεν βρίσκονται εντός του πυρήνα, άλλα στο κυτταρόπλασμα ενός ευκαρυωτικού κυττάρου) και ποια κύτταρα διαθέτουν μιτοχόνδρια (ευκαρυωτικά τόσο τα σωματικά όσο και οι γαμέτες), γνώσεις που απέκτησε από την Β’ Λυκείου!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ Λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει: ” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α (το γενετικό υλικό της Ντόλυ ήταν ανασυνδυασμένο με ανθρώπινο γενετικό υλικό, αφού έφερε το ανθρώπινο γονίδιο της ινσουλίνης στο πυρηνικό DNA της, μιας και το πυρηνικό γενετικό υλικό της, ήταν πανομοιότυπο με το πυρηνικό γενετικό υλικό του μαστικού σωματικού κυττάρου του εξάχρονου προβάτου που χρησιμοποιήθηκε ως κύτταρο δότης του πυρήνα) ή η δ; (στο πρώτο κεφάλαιο του βιβλίου της Γ΄ Λυκείου, αναφέρεται ότι τα μιτοχόνδρια είναι μητρικής προέλευσης και η εξήγηση αυτού δίνεται στο ένθετο (που είναι εκτός ύλης, σύμφωνα με το αναφερόμενο παραπάνω ΦΕΚ!) του κεφαλαίου 5 του ίδιου βιβλίου, όπου αναφέρεται ότι τα σπερματοζωάρια φέρουν τα μιτοχόνδρια τους στην ουρά τους και κατά την γονιμοποίηση, η ουρά του σπερματοζωαρίου δεν εισέρχεται στο ωάριο. Όμως για να επιλέξει ο μαθητής αυτή την απάντηση, που θεωρήθηκε και η μοναδική σωστή από την ΚΕΕ, πρέπει να γνωρίζει ότι τα μιτοχόνδρια του ωαρίου δεν είναι στον πυρήνα του, αλλά στο κυτταρόπλασμα του, ώστε να ξέρει ότι τα μιτοχόνδρια του διπλοειδούς κυττάρου που έδωσε την Ντόλυ, ήταν εκείνα που υπήρχαν στο κυτταρόπλασμα του απύρηνου ωαρίου που χρησιμοποιήθηκε και όχι στον πυρήνα του μαστικού σωματικού κυττάρου, του οποίου ο πυρήνας χρησιμοποιήθηκε. Ωστόσο, τη γνώση, ότι τα μιτοχόνδρια δεν βρίσκονται στον πυρήνα των ευκαρυωτικών κυττάρων, άλλα στο κυτταρόπλασμα τους, οι μαθητές την απέκτησαν στην β’ Λυκείου. Στο βιβλίο της Γ’ Λυκείου, δεν γίνεται σε κανένα σημείο του οποιαδήποτε τέτοια αναφορά, εκτός από την εικόνα 1.9. όπου όμως δεν διευκρινίζεται ποιος είναι ο πυρήνας του κυττάρου καθώς και στο απόσπασμα στο κεφ. 1 “Στα ευκαρυωτικά κύτταρα το γενετικό υλικό κατανέμεται στον πυρήνα, στα μιτοχόνδρια και στους χλωροπλάστες. Συνήθως όμως ο όρος γονιδίωμα αναφέρεται στο γενετικό υλικό που βρίσκεται στον πυρήνα” όπου όμως και πάλι δεν γίνεται σαφές ότι τα μιτοχόνδρια δεν είναι εντός του πυρήνα). Πώς λοιπόν, μπορεί να διαλέξει ο μαθητής τη μοναδική σωστή απάντηση, αφού αν δεν κάνει χρήση των γνώσεων που απέκτησε από την βιολογία γενικής παιδείας της Β’ Λυκείου, δεν μπορεί να επιλέξει την απάντηση δ. Αλλά, από την άλλη πλευρά, αν χρησιμοποιήσει τις γνώσεις της Β’ Λυκείου, τότε σωστή απάντηση είναι και η α.

Ένας μαθητής δηλαδή της Γ’ Λυκείου που δίνει εισαγωγικές εξετάσεις οφείλει να γνωρίζει από τη Β’ Λυκείου που βρίσκονται τα μιτοχόνδρια, ώστε μπορεί να αποκλείσει την επιλογή β στο παραπάνω ερώτημα κλειστού τύπου και να επιλέξει το δ, αλλά δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της Β’ Λυκείου για την Ντόλυ, ώστε να μην επιλέξει το α;

Επίσης να παρατηρηθεί ότι:

Ι) Στο αναφερόμενο ΦΕΚ και στο οριζόμενο από αυτό εξεταζόμενο σχολικό βιβλίο ορίζονται ως εκτός εξεταστέας ύλης, τα τμήματα του σχολικού βιβλίου με τίτλο:

i) Παραθέματα

ii) «Ας ερευνήσουμε …» στο τέλος κάθε κεφαλαίου.

Τα τμήματα αυτά δεν απαντώνται σε κανένα σημείο του βιβλίου όπως αυτό ορίζεται από το προαναφερόμενο ΦΕΚ!

Σημείωση: Παρακαλώ όπως ενημερωθώ μεσώ ηλεκτρονικού ταχυδρομείου για τον αριθμό πρωτοκόλλου που έλαβε η επιστολή μου.

ΜΑΡΓΑΡΙΤΗ ΝΙΚΟΛΕΤΤΑ

ΕΚΠΑΙΔΕΥΤΙΚΟΣ

Συνημμένα:

1.Απόσπασμα του αναφερόμενου ΦΕΚ

2.Αποσπάσματα από τα βιβλία της Β’ και Γ’ Λυκείου.

3.Απόσπασμα των θεμάτων των Ημερήσιων Λυκείων 2016 στη Βιολογία Ομάδας Θετικού Προσανατολισμού.