Monthly Archives: Ιουνίου 2014

Βιολογία Θετικής κατεύθυνσης το Δ θέμα στις εξετάσεις 2014!

 

Επιστημονικά λάθη φέτος στη Βιολογία κατεύθυνσης!

 

Τα φετινά θέματα της βιολογίας θετικής κατεύθυνσης μέχρι το ερώτημα Δ2 δεν χαρακτηρίζονται από καμιά πρωτοτυπία. Συγκεκριμένα το Α θέμα όπως πάντα από το 2003 και μετά αποτελούνταν από 5 ερωτήσεις πολλαπλής επιλογής που απαιτούσαν απλή ανάκληση γνώσεων από το σχολικό βιβλίο. Το Β θέμα βεβαίως αυτή τη φορά δεν απαιτούσε την παράθεση αυτούσιων τμημάτων του σχολικού βιβλίου αλλά, σε δυο ερωτήματα ζητούσε τοποθέτηση κατά χρονική σειρά και αντιστοίχηση και πάλι όμως αρκούσε η αυτούσια γνώση του σχολικού βιβλίου για να απαντηθεί. Το θέμα Γ για άλλη μια χρονιά ήταν μια κλασσική άσκηση του 5ου κεφαλαίου. Για άλλη μια φορά ήταν ένα πολύ απλό και εύκολο γενεαλογικό δένδρο που αφορούσε ένα κληρονομικό χαρακτηριστικό που όπως συνήθως ακολουθούσε αυτοσωμικό υπολειπόμενο τρόπο κληρονόμησης. Το θέμα Δ, μέχρι το ερώτημα Δ2 στερούνταν και πάλι πρωτοτυπίας αφού ζητούσε να βρεθεί η κωδική αλυσίδα του δοθέντος τμήματος γονιδίου, το mRNA και ο προσανατολισμός τους.

Είναι πράγματι άξιο απορίας γιατί τα θέματα της Bιολογίας εμφανίζουν τόσο μεγάλη επαναληψιμότητα, Μήπως δεν είναι η Βιολογία ένα επιστημονικό πεδίο ακόμα και σε επίπεδο λυκείου που έχει ποικιλία ασκήσεων και ερωτήσεων που απαιτούν κριτική σκέψη;

Πέραν όμως της στερούμενης πρωτοτυπίας των θεμάτων μέχρι το ερώτημα Δ2, στα επόμενα τρία ερωτήματα που ακολουθούσαν στο θέμα Δ τα ζητούμενα παρουσίαζαν πρωτοφανή πρωτοτυπία! Ζητούνταν από τους μαθητές να απαντήσουν στα ερωτήματα με επιστημονικώς λανθασμένες απαντήσεις!!!

Ας δούμε όμως καθένα από αυτά τα ερωτήματα ξεχωριστά:

 

Ερώτημα Δ3: Να γράψετε το τμήμα του mRNA στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1) το τμήμα του σχολικού βιβλίου που αφορά την έναρξη της μετάφρασης.

” κατά την έναρξη της μετάφρασης το mRNA προσδένεται, μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του με το ριβοσωμικό RNA της μικρής υπομονάδας του ριβοσώματος σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων.”

2) Το τμήμα του mRNA που προκύπτει από το δοθέν τμήμα του πρώτου γονιδίου του οπερονίου της λακτόζης (απάντηση ερωτήματος Δ2):

 

5′ AGCUAUGACCAUGUUACGGAUUCACUG3′

Σύμφωνα με αυτά, ο μαθητής παρατηρεί ότι το μόνο τμήμα 5′ αμετάφραστης περιοχής που του δίνεται είναι τα 4 νουκλεοτίδια που προηγούνται του κωδικονίου έναρξης της μετάφρασης (AUG), όποτε δεν του μένει άλλη επιλογή από το δώσει αυτήν την τετράδα νουκλεοτιδίων της 5′ αμετάφραστης περιοχής ως απάντηση, ανεξάρτητα από το αν τον προβληματίζει η διατύπωση του σχολικού βιβλίου “μεσώ μιας αλληλουχίας που υπάρχει στην 5′ αμετάφραστη περιοχή του”, το οποίο ορθώς αφήνει να εννοηθεί ότι αυτή η αλληλουχία δεν είναι ολόκληρη η 5΄αμετάφραστη περιοχή, όποτε δεν σημαίνει απαραίτητα ότι είναι σωστή η μοναδική απάντηση που μπορεί να δοθεί, δηλαδή τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής.

Πράγματι, όπως όφειλε να γνωρίζει ο θεματοδότης, τα 4 τελευταία νουκλεοτίδια της 5΄αμετάφραστης περιοχής των mRNAs του βακτηρίου E. coli, δεν αποτελούν την αλληλουχία σύνδεσης τους με το τμήμα του rRNA της μικρής ριβοσωμικής υπομονάδας. Η αλληλουχία αυτή στην 5′ αμετάφραστη περιοχή ονομάζεται Shine-Delgarno και είναι μια συντηρημένη αλληλουχία συνήθως 7-9 νουκλεοτιδίων πλουσίων σε Α και G (5’UAAGGAGGU3′)(πολλά textbooks βιολογίας π.χ. GeneVIII, άλλα και πιο ειδικά επιστημονικά άρθρα όπως JinH, ZhaoQ, GonzalezdeValdiviaEI, ArdellDH, StenströmM, IsakssonLA. Mol Microbiol. 2006 Apr; 60(2):480-92.καιDetermination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953) και η αλληλουχία αυτή (S-D) του mRNA απέχει από το κωδικόνιο έναρξης 4-5 νουκλεοτίδια! (Determination of the optimal aligned spacing between the Shine-Dalgarno sequence and the translation initiation codon of Escherichia coli mRNAs.Nucleic Acids Research. Nov 25, 1994; 22(23)4953).

 

Ερώτημα Δ4: Η φυσιολογική πρωτεΐνη, που παράγεται από την έκφραση του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης, αποτελείται από 1024 αμινοξέα. Μια γονιδιακή μετάλλαξη αντικατάστασης μιας βάσης στο παραπάνω τμήμα DNA οδηγεί στην παραγωγή μιας πρωτεΐνης με 1022 αμινοξέα, δηλαδή μικρότερης κατά δυο αμινοξέα . Να εξηγήσετε με ποιο τρόπο μπορεί να συμβεί αυτό.

 

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

 

1)τον ορισμό του οπερονίου της λακτόζης από το σχολικό βιβλίο.

2)τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων αντικατάστασης βάσης.

3)να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση του ερωτήματος “..στο παραπάνω τμήμα DNA.. “

 

Διερεύνηση

 

Ερμηνεία Ι). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται στο δοθέν από την εκφώνηση του Δ θέματος τμήμα DNA, του πρώτου δομικού γονιδίου του οπερονίου μήκους 28 ζευγών βάσεων, που κωδικοποιεί τα 8 πρώτα αμινοξέα του ενζύμου της β-γαλακτοσιδάσης.

Σε αυτή την περίπτωση η ζητούμενη απάντηση είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη οδήγησε στην κατάργηση του πρώτου κωδικονίου 5’ATG3′ στην κωδική αλυσίδα του γονιδίου και αντίστοιχα της τριπλέτας 3’ΤΑC5′ της μη κωδικής αλυσίδας του γονιδίου με συνεπεία την παράγωγη ενός μεταλλαγμένου μορίου mRNA που προέκυψε από την μεταγραφή του οπερονίου. Το μεταλλαγμένο αυτό mRNA, όταν μεταφράζεται το τμήμα του που κωδικοποιεί για την β-γαλακτοσιδάση να έχει ως συνεπεία η μετάφραση, εάν είναι βεβαίως αυτό εφικτό να γίνει , εξαιτίας των συγκεκριμένων διαστάσεων και του τρόπου δράσης του ριβοσώματος με το mRNA, να ξεκινήσει από το επόμενο 5’AUG3′ που υπάρχει στο μεταλλαγμένο mRNA. Η θέση του 5’AUG3′ αυτού εντοπίζεται ακριβώς ένα κωδικόνιο μετά το φυσιολογικό εναρκτήριο κωδικόνιο της μετάφρασης, όποτε η παραγόμενη πολυπεπτιδική αλυσίδα που θα προκύψει από την μετάφραση του μεταλλαγμένου τμήματος του mRNA του οπερονίου να είναι κατά δυο αμινοξέα μικρότερη.

Ωστόσο ο θεματοδότης όφειλε να γνωρίζει ότι αυτή η πιθανή απάντηση δεν είναι απαραίτητα σωστή επιστημονικώς. Σύμφωνα με όσα αναφέρθηκαν στο προηγούμενο ερώτημα, η έναρξη της μετάφρασης στα γονίδια το βακτηρίου E. coli είναι εφικτή όταν πληρούνται συγκεκριμένες προϋποθέσεις, όπως είναι η ύπαρξη άλλα και η σωστή απόσταση της αλληλουχίας S-D από την τριπλέτα 5’AUG3′ στο mRNA καθώς οι διαστάσεις του ριβοσώματος και ο τρόπος με τον οποίο αυτό συνδέεται με το mRNA είναι συγκεκριμένες/ος.

 

Ερμηνεία ΙΙ). Η φράση της εκφώνησης “στο παραπάνω τμήμα DNA αναφέρεται σε ολόκληρο το δομικό γονίδιο Ζ του οπερονίου της λακτόζης πέραν του δοθέντος τμήματος του, το οποίο εξετάστηκε αμέσως παραπάνω.

Σε αυτή την περίπτωση η απάντηση θα μπορούσε να είναι ότι η αναφερόμενη στην εκφώνηση μετάλλαξη αντικατάστασης βάσης οδήγησε σε ένα μεταλλαγμένο γονίδιο Ζ του οπερονίου. Όταν μεταγράφεται αυτό το μεταλλαγμένο οπερονίο οδηγεί σε να μόριο mRNA του οποίου το τμήμα του που κωδικοποιεί την β-γαλακτοσιδάση να διαφέρει από το φυσιολογικό λόγω αντικατάστασης μιας βάσης στο 1023ο κωδικονίο, με αποτέλεσμα να υπάρχει σε αυτή τη θέση κωδικονίο λήξης (κωδικονίο χωρίς νόημα). Το μεταλλαγμένο αυτό mRNA όταν μεταφράζεται το τμήμα του που κωδικοποιεί για τη β-γαλακτοσιδάση οδηγεί σε ένα μεταλλαγμένο ένζυμο μικρότερο από το φυσιολογικό στο καρβοξιτελικό άκρο του κατά δυο αμινοξέα.

Σε αυτή την περίπτωση, σύμφωνα με τα δεδομένα της εκφώνησης του ερωτήματος, αφού η μετάλλαξη που συνέβει είναι αντικατάστασης βάσης και η παραγόμενη πρωτεΐνη είναι κατά δυο αμινοξέα μικρότερη, μπορεί ο μαθητής να υποθέσει με ασφάλεια ότι το φυσιολογικό 1023ο κωδικονίο έχει τέτοια αλληλουχία που είναι δυνατό με μια αντικατάσταση βάσης να σχηματιστεί κωδικόνιο λήξης.

Με αυτή την ερμηνεία ο μαθητής δεν κινδυνεύει να δώσει επιστημονικώς λανθασμένη απάντηση, ανεξάρτητα από το αν δεν είναι υποχρεωμένος – είναι όμως οπωσδήποτε ο θεματοδότης που επιλεγεί αυτό το ερώτημα – να γνωρίζει σε βάθος επιστημονικές λεπτομέρειες για την έναρξη της μετάφρασης (βλέπε π.χ. παραπομπές παραπάνω).

 

Ερώτημα Δ5. Μια γονιδιακή μετάλλαξη που συνέβει στο ρυθμιστικό γονίδιο του οπερόνιου της λακτόζης οδηγεί στην παραγωγή ενός τροποποιημένου mRNA. Το mRNA αυτό φέρει τέσσερις επιπλέον διαδοχικές βάσεις μεταξύ του 3ο και 4ο κωδικονίου του. Να εξηγήσετε ποια θα είναι η συνεπεία στην παράγωγη των ενζύμων που μεταβολίζουν τη λακτόζη όταν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.

Για να απαντήσει ο μαθητής πρέπει να λάβει υπόψη του:

1)    Από το 7ο κεφάλαιο « όπως και όλοι οι υπόλοιποι οργανισμοί…διάφορες οργανικές ενώσεις όπως οι υδατάνθρακες.»

2)    Από το 2ο κεφάλαιο οτιδήποτε αναφέρει το σχολικό βιβλίο για το οπερόνιο της λακτόζης στο βακτήριο E.coli. και την τελευταία άσκηση του σχολικού βιβλίου στο 2ο κεφάλαιο.

3)    Από το 6ο κεφάλαιο τον ορισμό των μεταλλάξεων και ειδικότερα των γονιδιακών μεταλλάξεων και συγκεκριμένα τον ορισμό και τις επιπτώσεις των γονιδιακών μεταλλάξεων προσθήκης βάσεων, εντός της κωδικής περιοχής του γονιδίου, σε πλήθος που είναι μη ακέραιο πολλαπλάσιο του τρία.

4)    Να διερευνήσει την ερμηνεία της φράσης στην εκφώνηση «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης

 

Διερεύνηση:

 

Ερμηνεία Ι). Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στην μεταφορά και τον εμβολιασμό του μεταλλαγμένου στελέχους σε θρεπτικό υλικό απουσία πηγής άνθρακα με σκοπό την ανάπτυξη του σε αυτό το θρεπτικό μέσο.

Σε αυτήν την περίπτωση δεδομένου ότι το βακτήριο E. coli είναι ετερότροφο και σύμφωνα με τα παραπάνω αποσπάσματα του σχολικού βιβλίου, είναι βέβαιο ότι το βακτηριακό αυτό στέλεχος θα αδυνατεί να αναπτυχθεί σε αυτό το θρεπτικό υλικό, αφού δεν θα είναι δυνατή η τροφοδότηση του με άνθρακα. Η αδυναμία αυτή είναι ανεξάρτητη από την μετάλλαξη που φέρει το βακτηριακό αυτό στέλεχος στο ρυθμιστικό γονίδιο του οπερονίου της λακτόζης. Ωστόσο εάν η μετάλλαξη αυτή είχε ως συνεπεία έναν μη λειτουργικό καταστολέα που θα αδυνατεί να συνδεθεί με τον χείριστη του οπερονίου, θα επιβάρυνε ακόμη περισσότερο την αδυναμία του βακτηρίου να αναπτυχθεί σε θρεπτικό υλικό που στερείται πηγής άνθρακα καθώς σε αυτή την περίπτωση το οπερόνιο της λακτόζης θα εκφραζόταν συνεχώς, γεγονός ιδιαίτερα ενεργοβόρο, για όσο χρονικό διάστημα μπορούσε να παραμείνει στη ζωή το βακτηριακό κύτταρο μέχρι να εξαντληθούν τα αποθέματα ενέργειας του κυττάρου.

 

Ερμηνεία ΙΙ) . Η φράση της εκφώνησης «το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης.» αναφέρεται στο γεγονός ότι το βακτηριακό αυτό στέλεχος με το μεταλλαγμένο ρυθμιστικό γονίδιο έχει ήδη αναπτυχθεί και συνεχίζει να αναπτύσσεται σε θρεπτικό υλικό, το οποίο δεν διαθέτει ως πηγή άνθρακα ούτε γλυκόζη ούτε λακτόζη, αλλά υποθέτει ο μαθητής ότι περιέχει μια άλλη πηγή άνθρακα την οποία μπορεί να προμηθεύεται το βακτήριο από το θρεπτικό του υλικό.

Σε αυτή την περίπτωση διακρίνονται δυο περιπτώσεις:

περίπτωση Α). Η μετάλλαξη του ρυθμιστικού γονιδιού του οπερονίου της λακτόζης όπως περιγράφεται από την εκφώνηση του ερωτήματος και σε συνδυασμό με τα παραπάνω τμήματα του σχολικού βιβλίου που έλαβε ο μαθητής υπόψη του οδήγησε πιθανότατα σε μια πρωτεΐνη καταστολέα που είναι μη λειτουργική και αδυνατεί να αναγνωρίσει ή/και να προσδεθεί στον χείριστη του οπερονίου, οπότε το οπερόνιο της λακτόζης σε αυτή την περίπτωση θα εκφράζεται συνεχώς και θα παράγονται συνεχώς τα τρία ένζυμα που αυτό κωδικοποιεί, ανεξάρτητα από την παρουσία ή όχι λακτόζης στο θρεπτικό υλικό ανάπτυξης του βακτηρίου.

Περίπτωση Β). Η αναφερόμενη στην εκφώνηση μετάλλαξη δεν αποκλείεται να οδηγήσει σε έναν τροποποιημένο καταστολέα που μπορεί να συνδέεται στον χείριστη του οπερονίου , όμως δεν μπορεί να απομακρυνθεί από αυτόν είτε υπάρχει είτε δεν υπάρχει στο κύτταρο επαγωγέας του οπερονίου της λακτόζης. Σε αυτή την περίπτωση το οπερονιο της λακτόζης θα βρίσκεται μονίμως σε καταστολή και δεν θα παράγονται καθόλου τα ένζυμα που αυτό κωδικοποιεί.

Αυτές λοιπόν τις σκέψεις και τις παρατηρήσεις κλήθηκε να πραγματοποιήσει, προκείμενου να απαντήσει σωστά, φέτος ο υποψήφιος της θετικής κατεύθυνσης στα ερωτήματα Δ3, Δ4, Δ5!

Αξίζει να αναλογιστεί και να συνυπολογίσει κάνεις το γεγονός ότι η Βιολογία κατεύθυνσης έχει τον μεγαλύτερο συντελεστή βαρύτητας (1,3) για τις ιατρικές και τις συναφείς με τις ιατρικές σχόλες της χώρας!

Μήπως όμως δεν είναι τελικά έτσι; Μήπως η απαίτηση της επιτροπής που έβαλε τα θέματα ήταν απλώς ο μαθητής να μην ξέρει τίποτα, μα τίποτα άλλο πέρα από την στεγνή αποστήθιση του σχολικού βιβλίου και του τρόπου λύσης δυο κατηγοριών ασκήσεων χωρίς απαραίτητα να έχει πολυκαταλαβεί, διότι αν είχε καταλάβει κινδύνευε να μην απαντήσει “σωστά”;

Ας αναρωτηθεί όμως και κυρίως ας απαντήσει επισήμως και η Πανελληνία Ένωση Βιοεπιστημόνων, μελή της οποίας είναι οι θεματοδότες και οι διορθωτές των γραπτών των εξετάσεων, γιατί θα πρέπει να σιωπά όταν συμβαίνουν τέτοια πράγματα στις πανελλαδικές εξετάσεις στο μάθημα της Βιολογίας θετικής κατεύθυνσης!!!

Ποιοι είναι πιο ειδικοί για να απαντήσουν, αν όχι η επιτροπή παιδείας της Πανελληνίας Ένωσης Βιοεπιστημόνων;

Πόσα παιδιά θα τιμωρηθούν φέτος επειδή σκεφτήκαν σωστά και δεν στάθηκαν μόνο στο να αποστηθίσουν το σχολικό βιβλίο και δυο τύπους ασκήσεων ;

Πόσα παιδιά θα επιβραβευτούν φέτος επειδή το μόνο που έμαθαν στην Βιολογία θετικής κατεύθυνσης ήταν το σχολικό βιβλίο απέξω λέξη προς λέξη και τίποτα περισσότερο;

Είναι άδικο να επιβραβεύονται λαμβάνοντας ακόμα και τον ίδιο βαθμό εκείνοι οι μαθητές που απλώς μάντεψαν την απάντηση που θα ήθελε η επιτροπή, με εκείνα τα παιδιά που ανέπτυξαν κριτική σκέψη και παρατηρητικότητα και αιτιολόγησαν την απάντηση τους!

 

 

Advertisements