Monthly Archives: Δεκέμβριος 2011

Εξώφυλλο Βιβλίου Βιολογίας Θετικής Κατεύθυνσης Β' Τόμος

Ερωτήσεις κατανόησης 2ου Κεφαλαίου Βιολογία Θετικού Προσανατολισμού

  1. Τα διαφορετικά μονομερή που δομούν τα νουκλεϊκά οξέα είναι συνολικά πέντε.
  2. Invivo είναι αδύνατο να δημιουργηθεί φωσφοδιεστερικός δεσμός ανάμεσα σε δεσοξυριβονουκλεοτίδιο και ριβονουκλεοτίδιο.
  3. Όλες οι RNA πολυμεράσες δημιουργούν μόρια RNA διαβάζοντας DNA.
  4. Invivo συντίθεταιDNA με μήτρα ριβονουκλεϊκό οξύ.
  5. Οι Watson και Crick απέδειξαν τον ημισυντηρητικό τρόπο αντιγραφής του DNA.
  6. Οι διαδικασίες στα κύτταρα λαμβάνουν χώρα με την παρακάτω σειρά: Αντιγραφή->Μεταγραφή->Μετάφραση.
  7. Για τη μεταγραφή ενός γονιδίου απαιτείται η προσωρινή καταστροφή των νουκλεοσωμάτων.
  8. Η μεγάλη ποικιλία μεταγραφικών παραγόντων στα ευκαρυωτικά κύτταρα εξυπηρετεί την μεγάλη ποικιλία υποκινητών των γονιδίων τους.
  9. Η μεγάλη ποικιλία υποκινητών στα ευκαρυωτικά γονίδια εξυπηρετεί τον πολύ υψηλό βαθμό εξειδίκευσης των κυττάρων αυτών.
  10. Το μόριο tRNA με αντικωδικόνιο CATείναι φορτισμένομε το εναρκτήριο αμινοξύ της πρωτεϊνοσύνθεσης.
  11. Όλες οι πρωτεΐνες συντίθενται έχοντας ως πρώτο αμινοξύ την μεθειονίνη και δεν μπορούν να φέρουν αλλού αυτό το αμινοξύ.
  12. Ένα βακτηριακό στέλεχος E.coli είναι δυνατό να αδυνατεί να αναπτυχθεί παρουσία λακτόζης παρόλο που διαθέτει lac οπερόνιο.
  13. Η γονιδιακή ρύθμιση στα βακτήρια δεν μπορεί να στηρίζεται στην ποικιλία των βακτηριακών υποκινητών.
  14. Η κυτταρική διαφοροποίηση συμβαίνει μονάχα κατά την εμβρυακή ηλικία.
  15. Η υπερέκφραση ενός γονιδίου μπορεί να συμβεί με τη δημιουργία πολυσώματος και την πολλαπλή μεταγραφή του.
  16. Όταν δύο ζυγωτά φυτών βρεθούν στις ίδιες συνθήκες περιβάλλοντος θα δώσουν φυτά του ίδιου είδους.
  17. Η ικανότητα πρόσδεσης του mRNA με τα ριβοσώματα διαφέρει μεταξύ διαφορετικών μορίων mRNA.
  18. Το πολύσωμα είναι ένα σύμπλοκο ριβοσωμάτων με ένα μόριο mRNA.
  19. Το σύμπλεγμα έναρξης περιλαμβάνει ένα μόριο mRNA, ένα μόριο tRNA, ένα ορισμένο αμινοξύ και την μικρή υπομονάδα του ριβοσώματος.
  20. Το πριμόσωμα είναι ένα ειδικό σύμπλοκο ενζύμων.
  21. Την γενετική οδηγία για το χρώμα της ίριδας του προ-πάππου σας δεν αποκλείεται να την φέρετε και εσείς.
  22. Οι Monod και Jacob έθεσαν τα θεμέλια για την κατανόηση της ρύθμισης της έκφρασης της γενετικής πληροφορίας.
  23. Έστω ότι μέχρι σήμερα υπάρχουν γνήσιοι απόγονοι του Σωκράτη, τότε δεν αποκλείεται κάποιος από αυτούς να φέρει μόνο τον ένα από τους δύο κλώνους τουλάχιστον ενός από τα χρωμοσώματα του αρχαίου φιλόσοφου.
  24. Τα γονίδια των ευκαρυωτικών κυττάρων που κωδικοποιούν για μεταγραφικούς παράγοντες δεν απαιτούν για τη μεταγραφή τους κατάλληλο συνδυασμό από μεταγραφικούς παράγοντες.
  25. Τα θυγατρικά κύτταρα του ζυγωτού ενός είδους, όταν αναπτυχθούν στις ίδιες ακριβώς συνθήκες, θα δώσουν το καθένα το τμήμα του οργανισμού που θα έδινε αν παρέμεναν μαζί.
  26. Σε έναν πολυκύτταρο ευκαρυωτικό οργανισμό τα κύτταρα κάθε κυτταρικού τύπου περιέχουν καθορισμένη ποιότητα και ποσότητα πρωτεϊνών που διαφέρει από τα κύτταρα των άλλων κυτταρικών τύπων του ίδιου οργανισμού.
  27. Η DNA δεσμάση δεν δρα στο νεοσυντιθέμενο κλώνο που συντίθεται συνεχώς.
  28. Σε ένα προκαρυωτικό κύτταρο κατά την αντιγραφή του DNA δρουν ταυτόχρονα τέσσερις DNA πολυμεράσες που δημιουργούν τους νέους κλώνους.
  29. Σε όλα τα κύτταρα ενός οργανισμού εκφράζονται κάποια κοινά γονίδια π.χ. αυτά των ιστόνων.
  30. Η διαδικασία σύνθεσης νέου μορίου mRNA είναι δυνατό να ξεκινήσει πριν την ολοκλήρωση της μεταγραφής του γονιδίου.
  31. Η μεταγραφή των προκαρυωτικών γονιδίων λαμβάνει χώρα στο πυρηνοειδές.
  32. Πολλά μόρια RNAs μπορούν να μεταγράφονται ταυτόχρονα από μία μη-κωδική αλυσίδα.
  33. Η προσθήκη ενός ζεύγους νουκλεοτιδίων στο μεταφράσιμο τμήμα ενός γονιδίου έχει ως συνέπεια μια πρωτεΐνη που διαφέρει από την φυσιολογική κατά τρία αμινοξέα.
  34. Κατά την αντιγραφή του DNA ενός ανθρώπινου κυττάρου τοποθετούνται 12´109 νέα δεσοξυνουκλεοτίδια έτσι το γονιδίωμα μας μετά την αντιγραφή έχει μέγεθος 12´109  ζεύγη βάσεων.
  35. Η DNA πολυμεράση αναμένεται να τοποθετήσει λάθος 120.000 νουκλεοτίδια κατά την αντιγραφή των σωματικών κυττάρων μας και 60.000 νουκλεοτίδια κατά την αντιγραφή του γενετικού υλικού του γαμέτη μας.
  36. Στην φάση της μεσόφασης μετά την αντιγραφή του γενετικού υλικού μας, αναμένεται να υπάρχει ένα μόνο λάθος σε ζεύγη νουκλεοτιδίων σε ολόκληρο το γονιδίωμα μας.
  37. Όλα τα γονίδια ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  38. Όλα τα γονίδια όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  39. Όλα τα γονίδια έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  40. Όλες οι πρωτεΐνες ενός οργανισμού έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  41. Όλες οι πρωτεΐνες όλων των οργανισμών έχουν τις ίδιες φυσικοχημικές ιδιότητες.
  42. Οι πρωτεΐνες είναι τα βιολογικά μακρομόρια που καταλύουν τις βιοχημικές αντιδράσεις και συντελούν στην δόμηση των οργανισμών.
  43. Οι πρωτεΐνες στα κύτταρα αποτελούν κατά το πλείστων ανεξάρτητες και αυτόνομες μονάδες. Τα γονίδια στα κύτταρα δεν είναι ανεξάρτητες διακριτές μονάδες.
  44. Οι προκαρυωτικοί οργανισμοί δεν διαθέτουν επιδιορθωτικά ένζυμα και δεν επιτελούν μετά-μετάφραση στις πρωτεΐνες τους.
  45. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία νουκλεοτιδίων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  46. Το RNA που προκύπτει από την μεταγραφή είναι ίδιο σε αλληλουχία αζωτούχων βάσεων, μόνο που αντί για θυμίνη έχει ουρακίλη, με την κωδική αλυσίδα του γονιδίου που το κωδικοποιεί.
  47. Ο γενετικός κώδικας είναι σχεδόν καθολικός. Όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα. Το σχεδόν αναφέρεται π.χ. στις διαφορές στην αντιστοίχηση των κωδικονίων με τα αμινοξέα που εμφανίζονται στα μιτοχόνδρια των ζωικών κυττάρων.
  48. Κωδικόνια υπάρχουν και στην μη κωδική αλυσίδα ενός γονιδίου.
  49. Το E.coli έχει περίπου 3000 γονίδια και μέγεθος γονιδιώματος περίπου τέσσερα εκατομμύρια ζεύγη βάσεων.
  50. Στο οπερόνιο της λακτόζης τα τρία δομικά γονίδια (Z-Y-A) κωδικοποιούν για τις πρωτεΐνες β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση.
  51. Ένα ορισμένο μόριο mRNA  κωδικοποιεί για μια μοναδική πρόδρομη πολυπεπτιδική αλυσίδα. Μια συγκεκριμένη πρόδρομη πολυπεπτιδική αλυσίδα είναι δυνατόν να κωδικοποιείται από περισσότερες τις μιας διαφορικές αλληλουχίες νουκλεοτιδίων mRNA.
  52. Είναι δυνατόν να υπάρχουν δυο διαφορετικές πρωτεΐνες με την ίδια ποσοστιαία σύσταση σε αμινοξέα.
  53. Δεν υπάρχουν υποκινητές γονιδίων που να αποτελούνται από ριβονουκλεοτίδια.
  54. Συνήθως οι ιικοί υποκινητές είναι ισχυρότεροι από τους υποκινητές των γονιδίων των κυττάρων των ξενιστών των ιών.
  55. Το οπερόνιο που κωδικοποιεί τα ένζυμα για την βιοσύνθεση ενός αμινοξέος θα περιμέναμε να έχει ως επαγωγέας της έκφρασης του το ίδιο το αμινοξύ όταν αυτό βρίσκεται μέσα στο βακτηριακό κύτταρο.
  56. Κατά την μετα-μεταγραφή πραγματοποιείται και διάσπαση και δημιουργία ομοιοπολικών δεσμών.
  57. Κατά την μετα-μετάφραση πραγματοποιείται και διάσπαση και πιθανόν και δημιουργία ομοιοπολικών δεσμών.
  58. Κατά την ωρίμανση συμβαίνει πρώτα αποδιάταξη των δύο πολυνουκλεοτιδικών κλώνων.
  59. Μια πρόδρομη πρωτεΐνη 100 αμινοξέων υφίσταται μετα-μεταφραστική πρωτεϊνόλυση σε τρία σημεία της. Μεταξύ του πεμτου και έκτου αμινοξεος, μεταξύ του τεσσαρακοστού και του τεσσαρακοστού πρώτου και μεταξύ του εξηκοστού έκτου και εξηκοστού εβδόμου αμινοξέος. Το τμήμα με το αρχικό αμινικο άκρο απομακρύνεται η λειτουργική πρωτεΐνη θα αποτελείται από τρία πεπτίδια ενωμένα με δισουλφιδικούς δεσμούς.
  60. Οπερόνια υπάρχουν μόνο στο κυρίως γενετικό υλικό των βακτηρίων.
  61. Κάθε εξώνιο ενός διακεκομμένου γονιδίου πρέπει να αποτελείται από πλήθος ζευγών βάσεων που είναι ακέραιο πολλαπλάσιο του τρία.
  62. Τα εσώνια στα διακεκομμένα γονίδια είναι ζεύγη δεοξυνουκλεοτιδίων.
  63. Ο Τ2 έχει DNA δίκλωνα γονίδια, και μερικά έχουν και εσώνια.
  64. Πριν από την απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής, ένα από τα προτεινόμενα μοντέλα του μηχανισμού της αντιγραφής του DNA, ήταν ο δισπαρτικος. Σύμφωνα με αυτό τον μηχανισμό στο τέλος κάθε αντιγραφής προκύπτουν δυο νέα μόρια DNA αποτελούμενα το καθένα από δυο κλώνους, που ο καθένας αποτελείται από τυχαία τμήματα μητρικού και θυγατρικού κλώνου. Αν ένα βακτήριο αρχικά αναπτύσσεται σε περιβάλλον με 100% βαρύ Ν και μετά μεταφερθεί σε περιβάλλον με 100% ελαφρύ Ν και πραγματοποιηθούν  δυο διαδοχικές κυτταρικές διαιρέσεις, κάθε κύτταρο που προέκυψε από την δεύτερη διαίρεση θα φέρει ίση ποσότητα βαρύ Ν με κάθε κύτταρο που προέκυψε από την πρώτη διαίρεση, θεωρώντας ότι τα τμήματα του κάθε μορίου DNA που σχηματίζεται δημιουργούνται με τυχαία μεν άλλα ισοπίθανη κατανομή τμημάτων DNA μητρικών και θυγατρικών.
  65. Όλοι οι επιδιορθωτικοί μηχανισμοί που λειτουργούν κατά την αντιγραφή λειτουργούν και σε όλη την διάρκεια της μεσόφασης.
  66. οι 5΄και 3΄ αμετάφραστες  περιοχές ενός γονιδίου έχουν το ίδιο μέγεθος και διαφορετικό ρυθμιστικό ρόλο στην έκφραση των γονιδίων.
  67. Σύμφωνα με την θεωρία για την εξελικτική προέλευση των μιτοχονδρίων και των χλωροπλαστών θα αναμένετο τα γονίδια του DNA των οργανιδίων αυτών να μην έχουν εσώνια.
  68. Αποκοπή των εσωνίων και συρραφή των εξωνίων υφίστανται μόνο τα πρόδρομα mRNA των διακεκομμένων γονιδίων που κωδικοποιούν για πολυπεπτίδιο.
  69. Το σύνολο των διαδικασιών που περιλαμβάνει η ωρίμανση αφορά όλα τα πρόδρομα RNA.
  70. Τα tRNA γονίδια φέρουν τα αντικωδικόνια στην μη κωδική αλυσίδα τους.
  71. Υπάρχουν και μονόκλωνοι υποκινητές γονιδίων.
  72. ο κλώνος που αντιγράφεται ασυνεχώς έχει το 5′ άκρο του προς την ΘΕΑ.
  73. ο κλώνος που συντίθεται ασυνεχώς έχει το 3′ άκρο του προς τη ΘΕΑ.
  74. Στην φάση G2 του κυτταρικού κύκλου έχουμε 4 αντίγραφα ενός αυτοσωμικού γονιδίου και αν το γονίδιο εκφράζεται, τότε εκφράζονται και τα 4 αντίγραφα.
  75. Ο κανόνας της συμπληρωματικότητας και της αντιπαραλληλίας είναι τα κριτήρια της επιλογής από το ένζυμο της μεταγραφής, για το ποιος κλώνος του γονιδίου είναι ο μεταγραφόμενος.
  76. Η διατύπωση » έτσι τα δυο θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι πανομοιότυπα μεταξύ τους και με το μητρικό μόριο DNA» ,είναι λανθασμένη καθώς τα θυγατρικά μόρια είναι μεταξύ τους πανομοιότυπα άλλα όχι και πανομοιότυπα με το μητρικό μόριο DNA από το οποίο προήλθαν.
  77. Τα θυγατρικά μόρια DNA που προκύπτουν από την αντιγραφή είναι μικρότερου μήκους (σε πλήθος ζευγών βάσεων) από το μητρικό μόριο DNA.
  78. Η DNA δεσμάση δρα στην αρχή κάθε πρωταρχικού τμήματος κατά την αντικατάσταση του από την κατάλληλη DNA πολυμεράση.
  79. Τα αυτοσωμικά ομόλογα χρωμοσώματα έχουν ακριβώς τις ίδιες Θέσεις Έναρξης της Αντιγραφής.
  80. Οι αδελφές χρωματίδες έχουν ακριβώς τις ίδιες ΘΕΑ.
  81. Εντός ενός φυσιολογικού βακτηρίου E.coli, υπάρχουν ένας χείριστης του οπερονίου της λακτόζης και ένα πλήθος από πρωτεΐνες καταστολής.
  82. Το οπερόνιο της λακτόζης εκφράζεται πάντα σε φυσιολογικό κύτταρο E.coli  αρκεί να υπάρχουν μόρια λακτόζης εντός του, σε οποιοδήποτε πλήθος.
  83. Ένας ευκαρυωτικός γενετικός τόπος μπορεί να κωδικοποιεί για περισσότερες από ενός είδους διαφορετικές πολυπεπτιδικές αλυσίδες.
  84. Δίνεται η παρακάτω υποθετική κωδική αλυσίδα του γονιδίου Ζ του οπερονίου της λακτόζης: 5΄ΥΠΟΚΙΝΗΤΗΣ-ΧΕΙΡΙΣΤΗΣ-ATGACTGGATCATGCCATGGGGATG……………ΠΛΗΘΟΣ ΝΟΥΚΛΕΟΤΙΔΙΩΝ ΑΚΕΡΑΙΟ ΠΟΛΛΑΠΛΑΣΙΟ ΤΟΥ ΤΡΙΑ………………………………………………….ATGATGΤΑΑTGAGGTAGCCTAAGTCTGTA3′ το κωδικόνιο έναρξης βρίσκεται σίγουρα 11 νουκλεοτίδια μετά τον χειριστή.
  85. Ένα διακεκομμένο γονίδιο με 3 εσώνια δίνει 1 πρόδρομο και 8 διαφορετικά ώριμα μόρια mRNA.
  86. Εντός της μεγάλης υπομοναδας του ριβοσωματος κατά την επιμήκυνση του πολυπεπτιδίου δημιουργείται ένας ομοιοπολικός δεσμός και διασπάται ένας ομοιοπολικός δεσμός.
  87.  H DNA πολυμεράση μπαίνει στον πυρήνα όπως και τα μόρια snRNA.
  88. Τα μορια tRNA των προκαρυωτων και των ευκαρυωτων έχουν το ίδιο μέγεθος , δευτεροταγή δομή, και αλληλουχία και μορια με το ίδιο αντικωδικόνιο είναι φορτισμένα με το ίδιο αμινιξυ.
  89. Τα γονίδια που κωδικοποιούν για tRNA τόσο στους ευκαρυωτες όσο και στους  προκαρυωτες έχουν την ιδια αλληλουχία και το ίδιο μέγεθος.
  90. Το βακτηριακό γενετικό υλικο «κονταίνει» σε κάθε κύκλο αντιγραφής.
  91. Είναι δυνατόν να εισάγουμε βακτηριακο mRNA σε φυτικό εκχύλισμα και να πάρουμε πολυπεπτιδιο μικρότερο από το φυσιολογικό βακτηριακο πολυπεπτιδιο.
  92. Σε ένα πολυπεπτιδικό μόριο είναι δυνατόν το πλήθος των ομοιοπολικών δεσμών του που ενώνουν τα μονομερή  να είναι όσο και το πλήθος των μονομερών του.
  93. Μεταξύ των διαδικασιών του κεντρικού δόγματος της Βιολογιας που λαμβάνουν χώρα  σε ένα φυσιολογικό κύτταρο, η αντιγραφή, συμβαίνει μόνο μια φορά και η μεταγραφή και η μετάφραση πολλές φορές σε ίσο όμως πλήθος.
Advertisements

Διαγώνισμα εφ’ όλης της ύλης – Βιολογία γενικής

Εκφωνήσεις

ΖΗΤΗΜΑ 1ο                                                                                                                      Μονάδες 25

Α. Σε καθεμία από τις παρακάτω ερωτήσεις να επιλέξετε τη σωστή απάντηση.

Μόρια 15

1. Τα ειδικά νευρικά σωμάτια στο δέρμα μας, είναι:

  1. τα σημεία όπου εκκρίνεται ο ιδρώτας.
  2. τα σημεία όπου βρίσκονται οι σμηγματογόνοι αδένες
  3. οι θερμοϋποδοχείς της επιδερμίδας μας.
  4. το σημείο ελέγχου της ομοιόστασης του οργανισμού μας.

2. Ποιά παθογόνα μικρόβια γνωρίζετε, τα οποία παράγουν ωφέλιμες άλλα και επιβλαβείς χημικές ουσίες;

  1. Τα πρωτόζωα.
  2. Οι μύκητες.
  3. Τα βακτήρια.
  4. Οι ιοί.

3. Η καταστολή της ανοσοβιολογικής απόκρισης πραγματοποιείται:

  1. αποκλειστικά από τα ειδικά κατασταλτικά Τ-λεμφοκύτταρα.
  2. και από τα προϊόντα της ανοσοβιολογικής απόκρισης.
  3. στα πρωτογενή λεμφικά όργανα.
  4. μόνο κατά την πρωτογενή ανοσοβιολογική απόκριση.

4. Συνέπεια του φαινομένου του θερμοκηπίου, αναμένεται να είναι:

  1. η απώλεια μεγάλων χερσαίων εκτάσεων.
  2. καταρράκτης στα μάτια.
  3. γυψοποίηση.
  4. εύθραυστα κελύφη αυγών.

5. Ο γορίλας και ο γιββώνας ανήκουν………. ……………….. ………………, ο άνθρωπος και ο γορίλας ανήκουν…………. …………………….. ………………………… .:

  1. στην ίδια τάξη, στην ίδια οικογένεια.
  2. στο ίδιο γένος, στην ίδια οικογένεια.
  3. στην ίδια τάξη, στην ίδια κλάση.
  4. στην ίδια οικογένεια, στην ίδια τάξη.

Β. Σημειώστε ποια από τις παρακάτω προτάσεις είναι σωστή και ποια είναι λανθασμένη. Μόρια 10

1. Η ασθένεια του ύπνου θεραπεύεται με πενικιλίνη.

2. Το ινώδες δεν προϋπάρχει στο πλάσμα του αίματος, δημιουργείται στο πλάσμα από προϋπάρχουσες ουσίες, όταν αυτό απαιτείται.

3. Το 2ο τροφικό επίπεδο μίας πυραμίδας ενέργειας ενός οικοσυστήματος, απεικονίζει το ποσό της ενέργειας που είναι δεσμευμένο στα φυτοφάγα ζώα του.

4. Η συγκέντρωση ενός μη βιοδιασπώμενου ρύπου διατηρείται σταθερή μεταξύ των τροφικών επιπέδων, ενώ αυξάνεται η ποσότητα του από τροφικό επίπεδο σε τροφικό επίπεδο.

5. Το φαινόμενο του βιομηχανικού μελανισμού, αφορά έντομα του γένους betularia και ερμηνεύεται δια της θεωρίας της φυσικής επιλογής του Δαρβίνου.

ΖΗΤΗΜΑ 2ο

Μονάδες 25

Να απαντήσετε στις παρακάτω ερωτήσεις:

1. Να εξηγήσετε πώς δημιουργείται η όξινη βροχή.

Μόρια 6

2. Ποιά πρόβλεψη κάνουν οι επιστήμονες για το 2040; Θεωρείται ακριβής αυτή η πρόβλεψη;

Μόρια 6

3. Πού παράγεται το αίμα μας, από τι αποτελείται; Πως δημιουργείται το πύον κατά τη φλεγμονώδη αντίδραση;                                                                                                                                                  Μόρια 6

4. Με ποιο μηχανισμό ο άνθρωπος διατηρεί σταθερή τη θερμοκρασία του σώματός του, όταν βρεθεί σε περιβάλλον με θερμοκρασία υψηλότερη των 36,6οC;                                                          Μόρια 7

ΖΗΤΗΜΑ 3ο

Μονάδες 25

Επιστήμονες που μελετούσαν ένα είδος προϊστορικού εντόμου που βρέθηκε εγκλεισμένο σε κεχριμπάρι, νόσησαν από μία πρωτοεμφανιζόμενης συμπτωματολογίας ασθένεια, λίγες ημέρες μετά την απελευθέρωση του νεκρού εντόμου από το κεχριμπάρι.

Οι ιατροί που εξέτασαν τους ασθενείς, κατόρθωσαν να προσδιορίσουν την αιτία της ασθένειας, εφαρμόζοντας τα κριτήρια του R. Koch. Το αίτιο, αποδείχθηκε ότι ήταν ένα «νέο» είδος μικροοργανισμού, που διέθετε πυρηνοειδές και μαστίγιο. Οι ιατροί, απομόνωσαν το είδος αυτό, τόσο από το αίμα των ασθενών επιστημόνων, όσο και από το έντομο που αυτοί μελετούσαν.

1. Σε ποια κατηγορία παθογόνων μικροβίων ανήκει το αίτιο της νόσου που εμφάνισαν οι επιστήμονες;

Μόρια 3

2. Το μικρόβιο που προκάλεσε την ασθένεια των επιστημόνων, απομονώθηκε και από τα πόδια του εγκλεισμένου στο κεχριμπάρι εντόμου. Μπορείτε να εξηγήσετε τι συνέβη και νόσησαν οι επιστήμονες που μελετούσαν αυτό το προϊστορικό έντομο; Θα χαρακτηρίζατε αυτό το άγνωστο είδος μικροβίου, νέο;

Μόρια 6

3. Το μικρόβιο αυτό εμφανίζει ευαισθησία σε όλα τα γνωστά αντιβιοτικά αλλά και παράγει ένα εντελώς νέο αντιβιοτικό, για το οποίο, πολλά από τα συνήθη παθογόνα βακτήρια στα οποία δοκιμάστηκε δεν εμφανίζουν ανθεκτικότητα. Πώς μπορεί να ερμηνευθεί και να αξιοποιηθεί αυτό;

Μόρια 6

4. Το παρακάτω διάγραμμα παρουσιάζει τη μεταβολή του πλήθους των μικρόβιων συναρτήσει του χρόνου, όταν αυτό ήταν πάνω στο έντομο που βρέθηκε συντηρημένο στο κεχριμπάρι και εντός του σώματος ενός επιστήμονα που μελετούσε το απεγκλωβισμένο έντομο και νόσησε.

Στο διάγραμμα παρουσιάζεται και η μεταβολή της συγκέντρωσης των αντισωμάτων του ασθενούς από τη νόσο που προκαλεί αυτό το βακτηριακό είδος.

i. Ποια καμπύλη παριστάνει τα αντισώματα και ποια τα αντιγόνα; Τι είδους ανοσοβιολογική απόκριση εμφάνισε ο επιστήμονας;                                                                                                                            Μόρια 4

ii. Τι συνέβη τις χρονικές στιγμές t1 και t2; Αιτιολογήστε σύντομα την απάντησή σας.         Μόρια 6

ΖΗΤΗΜΑ 4ο

Μονάδες 25

Σε μια βραχονησίδα του Αιγαίου, την άνοιξη απαντώνται οι εξής βιοτικοί παράγοντες:

Θυμάρι, λεβάντα και πεύκα, επίσης ζουν κάμπιες πράσινες και καφετί, αγριοκούνελα με σταχτί τρίχωμα αλλά και αγριοκούνελα με καφετί τρίχωμα που είναι και τα περισσότερα. Ακόμη ζουν κοτσύφια που τρέφονται με κάμπιες και έντομα και γεράκια που κυνηγούν μικρά τρωκτικά και φυσικά υπάρχουν και μικροοργανισμοί του εδάφους που μεταξύ άλλων, παράγουν και αμμωνία. Το καλοκαίρι, οι κάμπιες μεταμορφώνονται σε έντομα, οι πράσινες κάμπιες μεταμορφώνονται σε κίτρινες πεταλούδες και οι καφετί κάμπιες σε πράσινα σκαθάρια, που είναι φυτοφάγα.

i. Κατατάξτε τους οργανισμούς του παραπάνω οικοσυστήματος, αναλόγως με τον τρόπο που προσπορίζονται την ενεργεία τους και με τον αριθμό βημάτων που αυτοί απέχουν από τον Ήλιο.

Μόρια 3

ii. Εάν η ενέργεια στο επίπεδο των παραγωγών είναι 5 x 108 Kj, ποια είναι η ενεργεία που υπάρχει στα γεράκια όταν αυτά προσπορίζονται το 70% της διαθέσιμης ενέργειας του τροφικού επιπέδου από το όποιο τρέφονται, ανεξαρτήτως εποχής;                                                                                                              Μόρια 3

iii. Ποιο είναι το ποσοστό της ενέργειας των παραγωγών που καταλήγει στα κοτσύφια;  Μόρια 2

iv. Το καλοκαίρι ξέσπασε πυρκαγιά, με αποτέλεσμα σε χρονικό διάστημα 10 περίπου ετών, ο αριθμός των σταχτί αγριοκούνελων να γίνει μεγαλύτερος από τον αντίστοιχο των καφετί. Δώστε μια εξήγηση για την διαφοροποίηση του πληθυσμού των αγριοκούνελων που παρατηρήθηκε. Πως αναμένετε να είναι ο πληθυσμός των κουνελιών σε 20 έτη μετά την πυρκαγιά, εάν δεν υπάρξει καμία άλλη παρέμβαση στο οικοσύστημα;

Μόρια 10

v. Πώς θα επηρεαζόταν ο πληθυσμός των εντόμων του νησιού αυτού, όταν μια ασθένεια των παραγωγών οδηγούσε σε φυλλόπτωση την άνοιξη και αυτή συνεχιζόταν και το καλοκαίρι;                   Μόρια 7

Απαντήσεις

ΖΗΤΗΜΑ 1o

 

A. Οι σωστές απαντήσεις είναι:

  1. 1.              iii
  2. 2.              iii
  3. 3.              ii
  4. 4.              i
  5. 5.              iv

 

B. Οι σωστές απαντήσεις είναι:

  1. 1.              Λ
  2. 2.              Σ
  3. 3.              Σ
  4. 4.              Λ
  5. 5.              Λ

 

ΖΗΤΗΜΑ 2o

 

1. Η ηφαιστειακή δραστηριότητα, οι διεργασίες αποικοδόμησης των οργανικών ουσιών από τα βακτήρια του εδάφους και κυρίως η καύση υγρών καυσίμων απελευθερώνουν στην ατμόσφαιρα διάφορα οξείδια του αζώτου και διοξείδιο του θείου. Τα αέρια αυτά, αφού πρώτα μετατραπούν, με την επίδραση των υδρατμών της ατμόσφαιρας, σε νιτρικό και θειώδες οξύ αντίστοιχα, επιστρέφουν στην επιφάνεια της Γης διαλυμένα στο νερό της βροχής, στο χιόνι, στην ομίχλη ή στο χαλάζι.

Όταν οι συγκεντρώσεις των οξειδίων αυτών δεν είναι αυξημένες, το νιτρικό και το θειώδες οξύ που βρίσκονται διαλυμένα στο νερό της βροχής την καθιστούν ελαφρά όξινη, καθώς έχει τιμή γύρω στο 5,6 pH. Στις περιοχές όμως στις οποίες η ατμόσφαιρα έχει επιβαρυνθεί με μεγάλες συγκεντρώσεις των οξειδίων αυτών, είτε διότι γίνεται εντατική καύση υγρών καυσίμων είτε διότι οι ρύποι αυτοί έχουν μεταφερθεί με τον άνεμο, μεγαλώνει και η ποσότητα του νιτρικού και του θειώδους οξέος που βρίσκονται διαλυμένα στο νερό της βροχής. Έτσι όμως η βροχή γίνεται περισσότερο όξινη, καθώς η τιμή του pH της μπορεί να πέσει αρκετά κάτω από το 5.

2. Επειδή η ποσότητα διοξειδίου του άνθρακα που προστίθεται στην ατμόσφαιρα αυξάνεται με ρυθμό 0,3% το χρόνο, πολλοί επιστήμονες πιστεύουν ότι το 2040 η μέση θερμοκρασία του πλανήτη μας θα έχει αυξηθεί κατά 5°C. Αν η πρόβλεψη αυτή επιβεβαιωθεί, τότε οι σοβαρές κλιματικές μεταβολές που θα προκύψουν θα έχουν δραματικές περιβαλλοντικές επιπτώσεις. Η τήξη των πολικών πάγων θα οδηγήσει

σε ανύψωση της στάθμης της θάλασσας και επομένως στην απώλεια μεγάλων χερσαίων εκτάσεων οι οποίες θα καλυφθούν από το νερό. Είναι επίσης πιθανό πολλές γόνιμες περιοχές να μετατραπούν σε άγονες και αντίστροφα. Πάντως, αν και είναι απαραίτητο να μειωθούν, σε παγκόσμιο επίπεδο, οι εκπομπές διοξειδίου του άνθρακα, καμία πρόβλεψη προς το παρόν δεν μπορεί να είναι απόλυτα ακριβής. Κι αυτό γιατί δεν είναι ακόμη πλήρως κατανοητή η πολυπλοκότητα των ατμοσφαιρικών φαινομένων και ιδιαίτερα ο τρόπος με τον οποίο αλληλεπιδρούν οι παράγοντες που ευθύνονται για την αύξηση της θερμοκρασίας του πλανήτη με τους μηχανισμούς που την εξισορροπούν.

3. Το αίμα, τόσο με τα έμμορφα συστατικά του (κύτταρα) όσο και με τα συστατικά του πλάσματος, αποτελεί το βασικότερο παράγοντα οργάνωσης της άμυνας (ειδικής και μη ειδικής) του ανθρώπινου οργανισμού. Όλα τα κύτταρα που συμμετέχουν στους μηχανισμούς άμυνας του οργανισμού μας προκύπτουν από τη διαφοροποίηση πολυδύναμων αιμοποιητικών κυττάρων, τα οποία βρίσκονται στον ερυθρό μυελό των οστών, που αποτελεί το κέντρο της αιμοποίησης.

Η φλεγμονώδης αντίδραση, ή απλά φλεγμονή, εκδηλώνεται με ένα σύνολο συμπτωμάτων στα οποία περιλαμβάνονται το κοκκίνισμα στην περιοχή του τραύματος, το οίδημα, ο πόνος και η τοπική αύξηση της θερμοκρασίας.

Στο «πεδίο της μάχης» που διεξάγεται μεταξύ των μικροβίων και των κυττάρων τα οποία υπερασπίζονται την υγεία μας υπάρχουν φυσικά απώλειες και από τα δύο «στρατόπεδα»: νεκρά φαγοκύτταρα και νεκροί μικροοργανισμοί σχηματίζουν ένα παχύρρευστο κιτρινωπό υγρό, το πύον.

4. Ένα από τα πιο χαρακτηριστικά παραδείγματα ομοιοστατικού μηχανισμού στον άνθρωπο είναι ο μηχανισμός ρύθμισης της θερμοκρασίας του σώματος στους 36,6°C. Πιο συγκεκριμένα, στην περίπτωση που βρεθούμε σε ένα χώρο με θερμοκρασία μεγαλύτερη από τους 36,6°C, η θερμότητα που φθάνει συνεχώς από το περιβάλλον στο σώμα μας τείνει να προκαλέσει αύξηση της θερμοκρασίας του. Ωστόσο η αύξηση αυτή δε συμβαίνει, εξαιτίας μιας σειράς διαδοχικών αντιδράσεων στις οποίες κύριο ρόλο παίζει ο εγκέφαλος. Αρχικά οι θερμοϋποδοχείς του δέρματός μας, δηλαδή τα ειδικά νευρικά σωμάτια που ανιχνεύουν τις μεταβολές της θερμοκρασίας του περιβάλλοντος, «ειδοποιούν» τον εγκέφαλο για την αύξηση της θερμοκρασίας με μηνύματα που αποστέλλουν στο κέντρο των γενικών αισθήσεων του εγκεφάλου. Στη συνέχεια το ειδικό κέντρο ρύθμισης της θερμοκρασίας του εγκεφάλου, με μηνύματα που αποστέλλει στους ιδρωτοποιούς αδένες και στα αγγεία της επιφάνειας του δέρματος, προκαλεί έκκριση ιδρώτα και διαστολή των αγγείων αντίστοιχα. Ο συνδυασμός αυτών των δύο αντιδράσεων συμβάλλει στη διατήρηση της θερμοκρασίας του σώματός μας με τον εξής τρόπο: τα αγγεία που έχουν διασταλεί φέρουν μεγάλες ποσότητες αίματος προς την επιφάνεια του δέρματος, η οποία όμως έχει ψυχθεί λόγω της εξάτμισης του ιδρώτα. Αυτό έχει ως αποτέλεσμα το αίμα που φθάνει στα αιμοφόρα αγγεία του δέρματος να ψύχεται και επιστρέφοντας με την κυκλοφορία στο εσωτερικό του

οργανισμού μας να αποτρέπει την αύξηση της θερμοκρασίας του.

 

ΖΗΤΗΜΑ 3ο

 

1. Το μικρόβιο το οποίο εντοπίστηκε στους ερευνητές και στο προϊστορικό έντομο, ήταν βακτήριο εφόσον διαθέτει πυρηνοειδές, δηλαδή δεν υπάρχει σε αυτό οργανωμένος πυρήνας και το γενετικό του υλικό (δίκλωνο κυκλικό DNA) βρίσκεται συγκεντρωμένο σε μία περιοχή του κυτταροπλάσματος (την πυρηνική περιοχή ή πυρηνοειδές). Επίσης διαθέτει μαστίγιο ως όργανο κίνησης.

2. Το μικροβιακό αυτό είδος, ήταν ένα είδος βακτηρίου που είχε τη δυνατότητα να μετατρέπεται σε ενδοσπόριο υπό αντίξοες συνθήκες. Τα ενδοσπόρια είναι αφυδατωμένα κύτταρα με ανθεκτικά τοιχώματα και χαμηλούς μεταβολικούς ρυθμούς. Έτσι, προφανώς την εποχή που βρισκόταν πάνω στο προϊστορικό έντομο επικράτησαν συνθήκες που οδήγησαν σε ενδοσπορίωση, εντωμεταξύ με την πάροδο των εκατοντάδων χιλιάδων ετών, το έντομο εγκλίστηκε εντέλει στο κεχριμπάρι μαζί με τα ενδοσπόρια των βακτηρίων που έφερε στο σώμα του. Όταν οι επιστήμονες απελευθέρωσαν το έντομο από το κεχριμπάρι, τα ενδοσπόρια που υπήρχαν πάνω στο νεκρό έντομο, βρέθηκαν σε ευνοϊκές συνθήκες και βλάστησαν, δίνοντας το καθένα, από ένα βακτηριακό κύτταρο δηλαδή τα ίδια κύτταρα που στους πρϊστορικούς χρόνους μετατράπηκαν σε ενδοσπόρια. Αυτά τα βακτήρια πολλαπλασιάστηκαν και μόλυναν τους ερευνητές, στο σώμα των οποίων εγκαταστάθηκαν και πολλαπλασιάστηκαν, προκαλώντας τους λοίμωξη, αφού οι ερευνητές ασθένησαν.

Το βακτηριακό αυτό είδος είναι ένα νέο είδος για την επιστήμη της μικροβιολογίας εφόσον δεν ήταν μέχρι σήμερα γνωστή η ύπαρξή του. Ωστόσο, είναι ένα μικρόβιο που υπήρξε στον πλανήτη πριν από εκατοντάδες χιλιάδες χρόνια και δεν γνωρίζουμε αν υπάρχουν ακόμη περιοχές (βιότοποι) του πλανήτη όπου διαβιεί αυτό το είδος βακτηρίων ή δεν γνωρίζουμε αν το είδος αυτό είχε εξαφανιστεί στην πάροδο των αιώνων που μεσολάβησαν ή εάν εξελίχθηκε από το προγονικό είδος που απομονώθηκε από τους ασθενείς και το προϊστορικό έντομο, και τώρα δεν υπάρχει πλέον.

3. Δεδομένου ότι αυτό το βακτηριακό είδος υπήρξε πριν από αιώνες στον πλανήτη, σε προϊστορικές εποχές, και παρέμεινε εγκλισμένο μέσα στο κεχριμπάρι όλους αυτούς τους αιώνες, χωρίς να αλληλεπιδρά με το περιβάλλον, με τους βιοτικούς και αβιοτικούς παράγοντες και κυρίως χωρίς να αλληλεπιδρά με άλλα βακτηριακά είδη και καθώς ήταν αδρανές αναπαραγωγικά και δίχως να είναι εκτεθιμένο σε παράγοντες που θα μπορούσαν να επηρρεάζουν την εξέλιξή του, το βακτηριακό αυτό είδος παρέμεινε ανέγγιχτο από την πιθανή τροποποίηση των ιδιοτήτων του και απρόσβλητο από τη φυσική επιλογή. Έτσι διατήρησε ανέπαφες τις γενετικές ιδιότητες που είχε πριν εγκλιστεί στο κεχριμπάρι. Αυτές τις ιδιότητές του, εντοπίζουν σήμερα οι επιστήμονες που το μελετούν. Μία από αυτές τις ιδιότητές του, ήταν και η παραγωγή ενός ασυνήθιστου – σήμερα – αντιβιοτικού. Καθώς επίσης και το γεγονός, ότι δεν διαθέτει ανθεκτικότητα σε κανένα από τα αντιβιοτικά που παράγονται από τα σύγχρονα μικρόβια, τα οποία πιθανόν δεν υπήρχαν την προϊστορική εποχή που ζούσε αυτό το «νέο» βακτηριακό είδος. Η παραγωγή αυτού του αντιβιοτικού, που παράγει αυτό το βακτήριο, στο οποίο εμφανίζουν ευαισθησία πολλά από τα συνήθη σύγχρονα παθογόνα βακτήρια, θα μπορούσε να χρησιμοποιηθεί ως θεραπευτικό μέσο για την θεραπεία των ασθενειών, που οφείλονται σε αυτά τα παθογόνα βακτήρια και τα οποία δεν είναι σήμερα εύκολο να καταπολεμηθούν από τα σύγχρονα αντιβιοτικά που χρησιμοποιούν εναντίον τους καθώς εμφανίζουν πλέον ανθεκτικότητα οι πληθυσμοί τους σε αυτά.

4. i. Η καμπύλη α παριστάνει τα αντιγόνα και η καμπύλη β παριστάνει τα αντισώματα εντός του σώματος του ασθενούς ερευνητή. Εφόσον ο ερευνητής δεν έχει ξαναμολυνθεί ποτέ στη ζωή του από το συγκεκριμένο βακτηριακό είδος και φυσικά δεν έχει εμβολιαστεί, εφόσον το είδος αυτό του παθογόνου παράγοντα ήταν άγνωστο μέχρι τώρα, ο οργανισμός του, πραγματοποίησε πρωτογενή ανοσιοβιολογική απόκριση για να αντιμετωπίσει μέσω της ειδικής άμυνας που διαθέτει, τον νέο εισβολέα. Κατά την πρωτογενή ανοσοβιολογική απόκριση η παραγωγή των αντισωμάτων από τον οργανισμό πραγματοποιείται συνήθως μεταξύ της 3ης με 4ης ημέρας μετά τη μόλυνση από τον παθογόνο παράγοντα, δηλαδή, πάντοτε η παραγωγή των αντισωμάτων έπεται της μόλυνσης του οργανισμού από ένα αντιγόνο. Στο δοθέν διάγραμμα είναι φανερό ότι η καμπύλη β, έπεται της καμπύλης α. Παράλληλα παρατηρούμε ότι η μέγιστη τιμή της καμπύλης β είναι μεγαλύτερη από τη μέγιστη τιμή της καμπύλης α και το μέγιστο της καμπύλης β συμπίπτει με τον μηδενισμό της καμπύλης α, που σημαίνει ότι τα αντισώματα στον οργανισμό του ασθενούς είναι περισσότερα από τα αντιγόνα και ο οργανισμός του  κατορθώνει να εξοντώσει τελικά τα αντιγόνα.

ii. Τη χρονική στιγμή t1 πραγματοποιήθηκε ο απεγκλωβισμός του προϊστορικού εντόμου από το κεχριμπάρι. Αρχικά τα ενδοσπόρια που υπήρχαν εγκλισμένα (πλήθος Ν1) μαζί με το προϊστορικό έντομο στο κεχριμπάρι εφόσον βρέθηκαν σε ευνοϊκές συνθήκες, βλάστησαν δίνοντας το κάθε ενδοσπόριο ένα βακτήριο. Τα βακτήρια που προέκυψαν από τη βλάστηση των ενδοσπορίων αναπαράγονται δίνοντας το καθένα δύο θυγατρικά κύτταρα κ.ο.κ.

Τη χρονική στιγμή t2 όπως προκύπτει από το δοθέν διάγραμμα πραγματοποιήθηκε η μόλυνση του ερευνητή από τα προϊστορικά βακτήρια. Από τη χρονική στιγμή t2 και μετά, η καμπύλη του δοθέντος διαγράμματος αφορά το πλήθος των μικροβίων εντός του σώματος του ερευνητή. Αρχικά τα βακτήρια διανύουν μία περίοδο επώασης εντός του σώματος του ερευνητή (t2 – t3) και από τη χρονική στιγμή t3 μέχρι τη χρονική στιγμή t4 εγκαθίστανται και πολλαπλασιάζονται εντός του οργανισμού που έχουν μολύνει, προκαλώντας του λοίμωξη. Όμως από τη χρονική στιγμή t4 και μετά, ο οργανισμός του ασθενούς παράγει αντισώματα εναντίον του συγκεκριμένου μικροβίου (πρωτογενής ανοσοβιολογική απόκριση), οπότε και ο οργανισμός αρχίζει να αντιμετωπίζει τον μικροοργανισμό μέσω της ειδικής άμυνας. Παρατηρούμε ότι καθώς αυξάνεται το πλήθος των παραγόμενων αντισωμάτων μειώνεται το πλήθος των παθογόνων μικροοργανισμών στον οργανισμό του ατόμου μέχρι τη χρονική στιγμή t5, οπότε και ο οργανισμός έχει καταπολεμήσει ολοκληρωτικά τον παθογόνο παράγοντα.

 

ΖΗΤΗΜΑ 4ο

 

i. Οι οργανισμοί που ζουν σε ένα οικοσύστημα διακρίνονται, ανάλογα με τον τρόπο που εξασφαλίζουν την τροφή τους, σε παραγωγούς, καταναλωτές και αποικοδομητές. Οι παραγωγοί είναι οι οργανισμοί που φωτοσυνθέτουν, έχουν δηλαδή την ικανότητα να δεσμεύουν την ηλιακή ενέργεια και να την αξιοποιούν για την παραγωγή γλυκόζης και άλλων υδατανθράκων από απλά ανόργανα μόρια (διοξείδιο του άνθρακα και νερό).

Όλοι οι άλλοι οργανισμοί των οικοσυστημάτων, οι οποίοι δε φωτοσυνθέτουν, χαρακτηρίζονται ως ετερότροφοι, γιατί παραλαμβάνουν με την τροφή τους τις χημικές ουσίες που είναι απαραίτητες για την κάλυψη των ενεργειακών αναγκών τους. Οι ετερότροφοι οργανισμοί διακρίνονται σε καταναλωτές και αποικοδομητές. Στους καταναλωτές, τους οργανισμούς δηλαδή που τρέφονται με φυτικούς ή άλλους ζωικούς οργανισμούς, ανήκουν οι μονοκύτταροι και οι πολυκύτταροι ζωικοί οργανισμοί. Οι καταναλωτές, ανάλογα με «τον αριθμό των βημάτων» που τους χωρίζουν από τους παραγωγούς, διακρίνονται σε:

• καταναλωτές πρώτης τάξης, που είναι τα φυτοφάγα ζώα,

• καταναλωτές δεύτερης τάξης, που είναι τα σαρκοφάγα ζώα τα οποία τρέφονται με φυτοφάγα,

• καταναλωτές τρίτης τάξης, που είναι τα σαρκοφάγα τα οποία τρέφονται με άλλα σαρκοφάγα.

Στους αποικοδομητές ανήκουν τα βακτήρια του εδάφους και οι μύκητες που τρέφονται με τη νεκρή οργανική ύλη (φύλλα, καρπούς, απεκκρίσεις, τρίχες, σώματα νεκρών οργανισμών).

Στο δοθέν οικοσύστημα της βραχονησίδας, οι οργανισμοί θυμάρι, λεβάντα και πεύκα είναι φυτά, και συνεπώς είναι παραγωγοί του οικοσυστήματος. Οι κάμπιες (πράσινες και καφετί) όπως και τα αγριοκούνελα (σταχτί και καφετί), ανήκουν στους καταναλωτές πρώτης τάξης, καθώς είναι φυτοφάγα πλάσματα. Τα πτηνά, κοτσίφια και γεράκια, που τρέφονται με φυτοφάγους οργανισμούς, κατατάσσονται στους καταναλωτές δεύτερης τάξης. Τέλος, οι μιρκοοργανισμοί του εδάφους που παράγουν αμμωνία, ανήκουν πιθανόν στου αποικοδομητές και συνεπώς είναι ετερότροφοι οργανισμοί.

ii. Οι οργανισμοί έχουν ανάγκη από ενέργεια την οποία εξασφαλίζουν με την τροφή τους. Οι τροφικές σχέσεις μεταξύ των οργανισμών διαφορετικών ειδών είναι ποιοτικές (ποιος τρώει ποιον) και ποσοτικές (τι ποσότητα τρώει).

Οι τροφικές πυραμίδες αποτελούν απεικονίσεις των ποσοτικών σχέσεων που υπάρχουν μεταξύ των οργανισμών ενός οικοσυστήματος. Μια τροφική πυραμίδα αποτελείται από τροφικά επίπεδα (επάλληλα ορθογώνια), σε καθένα από τα οποία περιλαμβάνονται όλοι οι οργανισμοί που τρέφονται απέχοντας «ίδιο αριθμό βημάτων» από τον ήλιο. Πιο συγκεκριμένα:

• Το πρώτο τροφικό επίπεδο, που βρίσκεται στη βάση της τροφικής πυραμίδας, είναι αυτό των παραγωγών.

• Το δεύτερο τροφικό επίπεδο είναι αυτό των καταναλωτών πρώτης τάξης.

• Το τρίτο τροφικό επίπεδο είναι αυτό των καταναλωτών δεύτερης τάξης κ.ο.κ.

Μία τροφική πυραμίδα, που απεικονίζει τη μεταβολή της δεσμευμένης ενέργειας από ένα τροφικό επίπεδο του οικοσυστήματος στο άλλο, χαρακτηρίζεται ως πυραμίδα ενέργειας.

Το εμβαδόν που δίνεται σε κάθε ορθογώνιο είναι ανάλογο με το μέγεθος της μεταβλητής που απεικονίζεται στο συγκεκριμένο τροφικό επίπεδο.

Αν θέλαμε να απεικονίσουμε την ενέργεια που περικλείεται στα διάφορα τροφικά επίπεδα του συγκεκριμένου οικοσύστηματος, θα παίρναμε:

Στην τροφική αλυσίδα, σε κάθε τροφικό επίπεδο, απεικονίζεται το ποσό της ενέργειας που είναι δεσμευμένο στο σύνολο των οργανισμών του δεδομένου τροφικού επιπέδου.

Η ενέργεια, με τη μορφή της χημικής ενέργειας που εμπεριέχεται στην τροφή των οργανισμών, περνάει από το κατώτερο τροφικό επίπεδο (των παραγωγών) στο ανώτερο. Έχει υπολογιστεί ότι μόνο το 10% περίπου της ενέργειας ενός τροφικού επιπέδου περνάει στο επόμενο, καθώς το 90% της ενέργειας χάνεται. Αυτό οφείλεται στο ότι:

• Ένα μέρος της χημικής ενέργειας μετατρέπεται με την κυτταρική αναπνοή σε μη αξιοποιήσιμες μορφές ενέργειας (π.χ. θερμότητα).

• Δεν τρώγονται όλοι οι οργανισμοί.

• Ορισμένοι οργανισμοί πεθαίνουν.

• Ένα μέρος της οργανικής ύλης αποβάλλεται με τα κόπρανα, τα οποία αποικοδομούνται.

Συνεπώς, η ενέργεια σε καθένα από τα τροφικά επίπεδα της προηγούμενης πυραμίδας, θα είναι:

Τα γεράκια, όπως και τα κοτσύφια, συνιστούν το τρίτο τροφικό επίπεδο αυτής της πυραμίδας, δεδομένου ότι ανάμεσα σε αυτά τα δύο είδη οργανισμών, τα γεράκια προσπορίζονται το 70 % της ενέργειας που διαθέτει το προηγούμενο τροφικό επίπεδο, όπου ανήκουν οι οργανισμοί, που συνιστούν τα θηράματα των οργανισμών του τρίτου τροφικού επιπέδου, η ενέργεια που υπάρχει δεσμευμένη στα γεράκια του οικοσυστήματος, είναι:

70/100 x 5 x 106Κj = 35/10 x 106Κj = 35 x 105Κj.

iii. Το ποσοστό της ενέργειας των παραγωγών που καταλήγει στα κοτσύφια του οικοσυστήματος, σύμφωνα με τα προηγούμενα, υπολογίζεται ως εξής:

Η ενέργεια που είναι δεσμευμένη στα κοτσύφια είναι:

5 x 106Κj – 35 x 105Κj = 50 x 105Κj – 35 x 105Κj = 15 x 105Κj.

Η ολική ενέργεια που υπάρχει δεσμευμένη στους παραγωγούς του οικοσυστήματος είναι 5 x108Κj. Άρα, αν το σύνολο της ενέργειας των παραγωγών κατέληγε στα κοτσύφια τότε θα περνούσε στα κοτσύφια το 100% της ενέργειας και θα διέθεταν ενέργεια ίση με αυτή των παραγωγών, δηλαδή 5 x108Κj. Όμως, σύμφωνα με το προηγούμενο ερώτημα, γνωρίζουμε ότι δεν καταλήγει όλη η ενέργεια των παραγωγών στα κοτσύφια, και υπολογίζουμε ότι η ενέργεια που εγκλύεται στα κοτσύφια είναι 15 x105Κj, συνεπώς μπορούμε να υπολογίσουμε το ποσοστό της ενέργειας των παραγωγών που φτάνει στα κοτσύφια. Αυτό είναι:

 

5 x 108Κj 100%

15 x 105Κj ψ%

 

5 x108Κj x ψ% = 15 x 105Κj x 100%

ψ% = 15 x 105Κj / 5 x 108Κj x 100%

ψ% = 3 x 10-3 = 0,003%

iv. Το μεσογειακό κλίμα χαρακτηρίζεται από αλληλοδιαδοχή ενός υγρού και σχετικά ήπιου θερμοκρασιακά χειμώνα με ένα θερμό και ξερό καλοκαίρι που ευνοεί την εκδήλωση της φωτιάς λόγω των υψηλών θερμοκρασιών, της μεγάλης ξηρασίας και της συσσώρευσης μη αποικοδομημένων ξερών φύλλων στο έδαφος.

Η πυρκαγιά είχε ως αποτέλεσμα σταδιακή διαφοροποίηση του πληθυσμού των αγριοκούνελων του οικοσυστήματος της βραχονησίδας που μελετάμε. Ενώ πριν την πυρκαγιά, τα καφετί κουνέλια επικρατούσαν στον πληθυσμό, μετά την πυρκαγιά, προοδευτικά, άρχισε να μειώνεται ο πληθυσμός τους και να αυξάνεται ο πληθυσμός των σταχτί αγριοκούνελων.

Η εξήγηση του φαινομένου βρίσκεται στη δράση της φυσικής επιλογής. Πριν από την πυρκαγιά τα καφετί αγριοκούνελα διακρίνονταν δυσκολότερα από τους θηρευτές τους (γεράκια) σε σχέση με τα αγριοκούνελα που διέθεταν σταχτί τρίχωμα. Αυτό συνέβαινε καθώς ο χρωματισμός του τριχώματος (καφετί) ήταν παραπλήσιος με το κυρίαρχο χρώμα του περιβάλλοντος όπως αυτό διαμορφωνόταν από τους κορμούς (καφετί) και το φύλλωμα των παραγωγών. Για το λόγο αυτό, επικράτησαν στον τοπικό πληθυσμό των αγριοκούνελων, τα καφετί κουνέλια αφού είχαν μεγαλύτερες πιθανότητες επιβίωσης – και μεταβίβασης του χαρακτηριστικού τους (καφετί τρίχωμα) στις επόμενες γενεές – από τα σταχτί.

Μετά την πυρκαγιά όμως, που το τοπίο απογυμνώθηκε από τη βλάστηση και έγινε γκρίζο, η δράση της φυσικής επιλογής αντιστράφηκε. Το προσαρμοστικό πλεονέκτημα, το είχαν πλέον τα σταχτί αγριοκούνελα, που ήταν περισσότερο δυσδιάκριτα από τα καφετί. Έτσι, βαθμιαία, άρχισαν να επικρατούν αριθμητικά, καθώς επιβιώνουν περισσότερο και μεταβιβάζουν με μεγαλύτερη συχνότητα το χρωματικό χαρακτηριστικό τους στις επόμενες γενεές από τα καφετί χρώματος αγριοκούνελα.

Τα μεσογειακά οικοσυστήματα μπορούν να επανακάμψουν σε λιγότερο από δέκα χρόνια, γιατί οι οργανισμοί τους έχουν προσαρμοστεί στην περιοδική εμφάνιση της φωτιάς αναπτύσσοντας συγκεκριμένους μηχανισμούς αναγέννησης. Χαρακτηριστικά παραδείγματα αποτελούν ο σχηματισμός νέων βλαστών και φύλλων από υπόγειους οφθαλμούς, η αυξημένη φύτρωση σπερμάτων που διασκορπίστηκαν λόγω της φωτιάς κ.ά. Συνεπώς, εφόσον δεν δράσουν κάποιοι ανασταλτικοί παράγοντες στη επανάκαμψη του συγκεκριμένου οικοσυστήματος και εφόσον δεν υπάρξουν άλλες παρεμβάσεις, φυσικές ή τεχνητές, αναμένεται ότι σε είκοσι χρόνια μετά την πυρκαγιά στον πληθυσμό των αγριοκούνελων της βραχονησίδας, θα επικρατούν και πάλι τα καφετί κουνέλια, αφού μετά από μία δεκαετία από την πυρκαγιά, το τοπίο θα έχει επανέλθει στην κατάσταση που βρισκόταν πριν από την πυρκαγιά. Έτσι, και πάλι η φυσική επιλογή θα δράσει υπέρ του καφετί τριχώματος τρωκτικών αφού και τώρα είναι δυσκολότερο να εντοπιστούν από τους θηρευτές τους, δηλαδή τα γεράκια, σε αντίθεση με τα σταχτί τριχώματος ζώα. Έτσι, το οικοσύστημα θα επανέλθει στην αρχική του ισορροπία.

 

Σχόλιο: Μετά την πυρκαγιά αναμένεται να μειωθεί συνολικά ο πληθυσμός των αγριοκούνελων, αφού θα περιοριστεί η τροφή τους. Ομοίως θα πρέπει αναλογικά να μειωθεί και ο πληθυσμός των γερακιών. Μετά όμως από είκοσι χρόνια, εφόσον δεν υπάρξουν άλλοι περιοριστικοί παράγοντες, αφού το πλήθος των παραγωγών θα έχει αποκατασταθεί συνακόλουθα θα αποκατασταθεί και το πλήθος των καταναλωτών αυτής της τροφικής αλυσίδας.

 

v. Τα οικοσυστήματα χαρακτηρίζονται από την τάση να διατηρούν σε ισορροπία τις σχέσεις που αναπτύσσονται μεταξύ των διάφορων βιοτικών και αβιοτικών παραγόντων τους. Η ισορροπία όμως αυτή των οικοσυστημάτων δεν αντιπροσωπεύει μια στατική κατάσταση. Αντίθετα, οι σχέσεις που αναπτύσσονται μεταξύ των παραγόντων ενός οικοσυστήματος μεταβάλλονται συνεχώς και ποσοτικά και ποιοτικά. Οι μηχανισμοί όμως αυτορρύθμισης που διαθέτει κάθε οικοσύστημα το κάνουν ικανό να επαναφέρει την ισορροπία στις σχέσεις μεταξύ βιοτικών και αβιοτικών παραγόντων, όποτε μια μεταβολή τείνει να τις απορρυθμίσει.

Στο οικοσύστημα της βραχονησίδας που μελετάμε σχετικά με τον πληθυσμό των εντόμων αναμένεται ότι με τη φυλλόπτωση που θα συμβεί, οι πληθυσμοί των πεταλούδων και των σκαθαριών θα μειωθούν διότι θα μειωθούν οι κάμπιες, οι οποίες μεταμορφώνονται σε έντομα την άνοιξη, καθώς αυτές τρέφονται με φύλλα και με την φυλλόπτωση θα περιοριστεί η τροφή τους. Εφόσον όμως ένα μέρος του πληθυσμού από τις κάμπιες επιβιώσει, τότε τα έντομα που θα προκύψουν, θα έρθουν και αυτά αντιμέτωπα με την αιτία, το καλοκαίρι καθώς η φυλλόπτωση επικρατεί και η ανάπτυξη των φυτών από τα οποία τρέφονται περιορίζεται.Επιπροσθέτως όλων των παραπάνω παραγόντων, στο συγκεκριμένο οικοσύστημα, αναμένεται ότι υπό φυσιολογικές συνθήκες ότι τα πράσινα σκαθάρια θα είναι περισσότερο δυσδιάκριτα από τους θηρευτές τους (κοτσύφια), σε σχέση με τις κίτρινες πεταλούδες, οπότε αναμένεται ο πληθυσμός τους να είναι μεγαλύτερος. Μετά τη φυλλόπτωση όμως, αναμένεται τα πράσινα σκαθάρια να γίνουν και αυτά ευδιάκριτα για τα κοτσύφια, όπως είναι και οι πεταλούδες. Συνεπώς μία τέτοια επίδραση στους παραγωγούς του οικοσυστήματος, θα οδηγούσε σε επιπτώσεις στον πληθυσμό των εντόμων, στα οποία τώρα ο πληθυσμός των σκαθαριών θα μειωθεί. Ο πληθυσμός των πεταλούδων αναμένεται είτε να παραμείνει αμετάβλητος, εφόσον τα κοτσύφια δεν αυξηθούν, αλλά απλώς να αλλάξουν διατροφικές συνήθειες και να στραφούν και προς τα σκαθάρια που τώρα είναι περισσότερο ευδιάκριτα, είτε ο πληθυσμός των πεταλούδων να μειωθεί και αυτός εάν ο πληθυσμός των κοτσυφιών αυξηθεί καθώς θα έχουν στη διάθεσή τους περισσότερη τροφή (σκαθάρια).

Οι μηχανισμοί που θα δρουν υπέρ της μίας ή της άλλης εκδοχής, εξαρτώνται και από άλλους παράγοντες. Σε κάθε περίπτωση ωστόσο, οι τροποποιήσεις αυτές αναμένεται να είναι προσωρινές εφόσον οι αυτορυθμιστικοί μηχανισμοί του οικοσυστήματος θα δράσουν για να επανέλθει σε ισορροπία η οποία μπορεί να είναι ίδια με την αρχική ή μία νέα κατάσταση ισορροπίας. Ο πληθυσμός πάντως των καταναλωτών 1ης τάξης (έντομα του οικοσυστήματος) καθορίζεται από την ενέργεια που διαθέτουν οι παραγωγοί, όπως και ο πληθυσμος των καταναλωτών της 2ης τάξης καθορίζεται από από την ενέργεια που διαθέτει το προηγούμενο τροφικό επίπεδο, δηλαδή στην προκειμένη περίπτωση τα έντομα.