Monthly Archives: Ιουλίου 2011

Θέματα ημερησίων λυκείων 2009

ΑΠΟΛΥΤΗΡΙΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΕΝΙΑΙΟΥ ΛΥΚΕΙΟΥ 2009
ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ
ΒΙΟΛΟΓΙΑ
ΘΕΜΑ 1ο
Να γράψετε στο τετράδιό σας τον αριθμό καθεμιάς από τις παρακάτω ημιτελείς προτάσεις 1 έως 5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή τη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση.
1. Στο οπερόνιο της λακτόζης δεν περιλαμβάνεται
α. χειριστής.
β. υποκινητής.
γ. snRNA.
δ. δομικά γονίδια.
Μονάδες 5
2. Τα νουκλεοσώματα
α. αποτελούνται αποκλειστικά από DNA.
β. δεν σχηματίζονται κατά τη μεσόφαση.
γ. αποτελούνται από DNA που τυλίγεται γύρω από πρωτεΐνες.
δ. είναι ορατά μόνο με το οπτικό μικροσκόπιο.
Μονάδες 5
3. Σε άτομα που πάσχουν από μια μορφή εμφυσήματος χορηγείται
α. παράγοντας ΙΧ.
β. αυξητική ορμόνη.
γ. ινσουλίνη.
δ. α1 – αντιθρυψίνη.
Μονάδες 5
4. ∆ιαγονιδιακά είναι φυτά
α. τα οποία έχουν υποστεί γενετική αλλαγή.
β. στα οποία έχουν εισαχθεί ορμόνες.
γ. τα οποία έχουν εμβολιαστεί με αντιγόνα in vitro.
δ. στα οποία έχουν εισαχθεί αντιβιοτικά.
Μονάδες 5
5. Μετασχηματισμός βακτηριακού κυττάρου ξενιστή είναι
α. η εισαγωγή αντισώματος.
β. η εισαγωγή DNA πλασμιδίου.
γ. η εισαγωγή θρεπτικών συστατικών.
δ. η εισαγωγή αντίστροφης μεταγραφάσης.
Μονάδες 5
ΘΕΜΑ 2ο
Να απαντήσετε στις παρακάτω ερωτήσεις:
1. Τι εννοούμε με τον όρο ζύμωση και ποια τα προϊόντα της;
Μονάδες 4
2. Πώς τα μονοκλωνικά αντισώματα χρησιμοποιούνται στη θεραπεία του καρκίνου; (Μονάδες 5) Ποια είναι τα πλεονεκτήματά τους συγκριτικά με άλλες μεθόδους θεραπείας; (Μονάδες 2)
Μονάδες 7
3. Τι είναι η μετατόπιση και τι είναι η αμοιβαία μετατόπιση; Ποια προβλήματα μπορεί να προκαλέσει η αμοιβαία μετατόπιση στον άνθρωπο;
Μονάδες 6
4. Ποιες ομάδες ατόμων είναι απαραίτητο να ζητήσουν γενετική καθοδήγηση;
Μονάδες 8
ΘΕΜΑ 3ο
Α. Στα παρακάτω γενεαλογικά δέντρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες 1 και 2.
Γενεαλογικό δένδρο
Στην 1η οικογένεια φέρουν το χαρακτηριστικό τα άτομα Ι2, ΙΙ2, ΙΙ3 (μαυρισμένα) ενώ στην 2η οικογένεια φέρουν το χαρακτηριστικό τα άτομα ΙΙ2, ΙΙ3 (μαυρισμένα). Να προσδιορίσετε τον τρόπο κληρονόμησης του χαρακτηριστικού με βάση τα παραπάνω στοιχεία, αιτιολογώντας την απάντησή σας με τις κατάλληλες διασταυρώσεις (να μη ληφθεί υπόψη η περίπτωση μετάλλαξης και να μην εξεταστεί η περίπτωση του φυλοσύνδετου επικρατούς γονιδίου). (Μονάδες 8) Να γράψετε τους γονότυπους όλων των ατόμων. (Μονάδες 5)
Μονάδες 13
Β. Να υποδείξετε ένα πιθανό μηχανισμό που μπορεί να εξηγήσει τη γέννηση ατόμου με σύνδρομο Τurner από γονείς με φυσιολογικό αριθμό χρωμοσωμάτων. (Μονάδες 6) Να περιγράψετε τη διαδικασία με την οποία μπορούμε να απεικονίσουμε τα χρωμοσώματα του ατόμου με σύνδρομο Turner, μετά τη γέννησή του. (Μονάδες 6)
Μονάδες 12
ΘΕΜΑ 4ο
∆ίνεται δίκλωνο μόριο DNA, το οποίο περιέχει τμήμα ασυνεχούς γονιδίου που μεταγράφεται σε mRNA.
Αλληλουχία γονιδίων
α. Πού συναντάμε ασυνεχή γονίδια; (μονάδες 2)
β. Να προσδιορίσετε τα 3΄ και 5΄ άκρα του παραπάνω μορίου DNA. (Μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (Μονάδες 4)
γ. Να γράψετε το τμήμα του πρόδρομου mRNA και του ώριμου mRNA που προκύπτουν από τη μεταγραφή του παραπάνω μορίου DNA, χωρίς αιτιολόγηση. (Μονάδες 2)
δ. Πώς προκύπτει το ώριμο mRNA; (Μονάδες 3)
ε. Μπορεί η περιοριστική ενδονουκλεάση ΕcoRI να κόψει το παραπάνω τμήμα DNA; (Μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (Μονάδες 3)
στ. Ποιες κατηγορίες γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου δεν κλωνοποιούνται σε cDNA βιβλιοθήκη; (μονάδες 8)
Μονάδες 25
ΑΠΑΝΤΗΣΕΙΣ ΑΠΟΛΥΤΗΡΙΩΝ ΕΞΕΤΑΣΕΩΝ 2009
ΘΕΜΑ 1o
Οι σωστές απαντήσεις είναι:
1. γ
2. γ
3. δ
4. α
5. β
ΘΕΜΑ 2o
1. Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες. Ο όρος ζύμωση παλιότερα χρησιμοποιείτο μόνο για αναερόβιες διεργασίες αλλά σήμερα χρησιμοποιείται με την ευρεία έννοια και περιλαμβάνει όλες τις διεργασίες αερόβιες και αναερόβιες.
Τα προϊόντα της ζύμωσης είναι είτε τα ίδια τα κύτταρα που ονομάζονται βιομάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά.
2. Το ιδανικό φάρμακο σύμφωνα με το Γερμανό γιατρό Ehrlich είναι αυτό που μπορεί να καταπολεμά αποτελεσματικά τις μολύνσεις, χωρίς να προκαλεί παρενέργειες στον οργανισμό. Η φύση έχει δημιουργήσει το ιδανικό φάρμακο, τα αντισώματα. Τα αντισώματα είναι πρωτεΐνες που παράγονται φυσιολογικά από τα Β-λεμφοκύτταρα του οργανισμού μας και ρόλος τους είναι να εντοπίζουν και να καταστρέφουν αντιγόνα που εισέρχονται στον οργανισμό. Στην πραγματικότητα τα αντισώματα αναγνωρίζουν περιοχές των αντιγόνων που ονομάζονται αντιγονικοί καθοριστές. Ένα μεγάλο αντιγόνο μπορεί να έχει παραπάνω από έναν αντιγονικό καθοριστή, οπότε και να παράγονται γι’ αυτό περισσότερα του ενός είδους αντισωμάτων. Κάθε είδος αντισωμάτων παράγεται από μια ομάδα όμοιων Β-λεμφοκυττάρων, που αποτελούν ένα κλώνο. Τα αντισώματα που παράγονται από ένα κλώνο όμοιων Β-λεμφοκυττάρων, ονομάζονται μονοκλωνικά αντισώματα.
Τα αντισώματα είναι ιδιαίτερα σημαντικά για την ιατρική καθώς χρησιμοποιούνται ως ανοσοδιαγνωστικά για την ανίχνευση ασθενειών αλλά και ως εξειδικευμένα φάρμακα εναντίον παθογόνων μικροοργανισμών. Ιδιαίτερα σημαντική είναι η χρήση τους ως θεραπευτικά για τη θεραπεία του καρκίνου.
Τα καρκινικά κύτταρα έχουν στην εξωτερική επιφάνειά τους μεγάλη ποικιλία αντιγόνων που δεν υπάρχουν στα φυσιολογικά κύτταρα του οργανισμού, και ονομάζονται καρκινικά αντιγόνα. Έτσι μπορούν να κατασκευαστούν μονοκλωνικά αντισώματα εναντίον αυτών των αντιγόνων. Τα μονοκλωνικά αντισώματα είναι πολύ ειδικά μόνο για τα καρκινικά κύτταρα και μπορούν να «γίνουν μεταφορείς» ισχυρών αντικαρκινικών φαρμάκων. Όταν εισαχθούν στον οργανισμό, βρίσκουν και προσβάλλουν τους καρκινικούς στόχους. Τα αντικαρκινικά φάρμακα, που είναι συνδεδεμένα με τα αντισώματα, δρουν κατευθείαν στα καρκινικά κύτταρα και τα καταστρέφουν. Επιτρέπουν έτσι τη θεραπεία με αποφυγή της χειρουργικής επέμβασης και των δυσάρεστων συνεπειών της χημειοθεραπείας.
3. Οι μεταλλάξεις είναι αλλαγές στην ακολουθία και στον αριθμό των νουκλεοτιδικών βάσεων στο γονιδίωμα ενός οργανισμού. Οι μεγάλες σε έκταση αλλαγές αποτελούν τις χρωμοσωμικές ανωμαλίες. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες, ενώ οι αλλαγές στη δομή αποτελούν τις δομικές χρωμοσωμικές ανωμαλίες. Οι αλλαγές αυτές έχουν συνήθως ως αποτέλεσμα την τροποποίηση του φαινοτύπου του ατόμου. Η ανάλυση των χρωμοσωμικών ανωμαλιών έγινε δυνατή μετά την ανάπτυξη τεχνικών που επιτρέπουν την παρατήρηση και τη λεπτομερή μελέτη των χρωμοσωμάτων.
Οι δομικές χρωμοσωμικές ανωμαλίες είναι αλλαγές στη δομή ενός ή περισσότερων χρωμοσωμάτων. Οι δομικές αλλαγές στο χρωμόσωμα μπορεί να αφορούν μερικά γονίδια ή ένα μεγάλο τμήμα του χρωμοσώματος. Η δημιουργία δομικών χρωμοσωμικών ανωμαλιών μπορεί να είναι αποτέλεσμα διαφόρων μηχανισμών κατά τη διάρκεια του κυτταρικού κύκλου. Για παράδειγμα, η θράυση τμήματος από ένα ή περισσότερα χρωμοσώματα και, στη συνέχεια, η λανθασμένη επανένωσή του μπορεί να έχει ως αποτέλεσμα έλλειψη, μετατόπιση ή κάποια άλλη αναδιάταξη των γονιδίων στο χρωμόσωμα. Οι δομικές χρωμοσωμικές ανωμαλίες είναι επίσης αποτέλεσμα της δράσης μεταλλαξογόνων παραγόντων όπως οι ακτινοβολίες και οι διάφορες χημικές ουσίες.
Οι δομικές χρωμοσωμικές ανωμαλίες έχουν, όπως ειπώθηκε, ως αποτέλεσμα την αλλαγή στην ποσότητα ή στη διάταξη της γενετικής πληροφορίας στα χρωμοσώματα. Ανάλογα με τον τύπο της αλλαγής διακρίνονται διάφορα είδη δομικών χρωμοσωμικών ανωμαλιών (αναστροφή, έλλειψη, διπλασιασμός, μετατόπιση, αμοιβαία μετατόπιση).
Συγκεκριμένα, η μετατόπιση είναι αποτέλεσμα θραύσης ενός τμήματος του χρωμοσώματος και στη συνέχεια ένωσής του σε ένα άλλο μη ομόλογο χρωμόσωμα. Στις αμοιβαίες μετατοπίσεις έχουμε «ανταλλαγή» χρωμοσωμικών τμημάτων ανάμεσα σε μη ομόλογα χρωμοσώματα. Στις αμοιβαίες μετατοπίσεις δε χάνεται γενετικό υλικό και τα άτομα που τις φέρουν εμφανίουν συνήθως φυσιολογικό φαινότυπο. Ταυτόχρονα όμως εμφανίζουν κίνδυνο απόκτησης απογόνων με χρωμοσωμικές ανωμαλίες, επειδή κατά το ζευγάρωμα των χρωμοσωμάτων στη μειωτική διαίρεση προκύπτουν και μη-φυσιολογικοί γαμέτες.
4. Η γενετική καθοδήγηση είναι μία διαδικασία κατά την οποία ειδικοί επιστήμονες δίνουν πληροφορίες σε μεμονωμένα άτομα, ζευγάρια και οικογένειες που πάσχουν από κάποια γενετική ασθένεια ή έχουν αυξημένες πιθανότητες να την εμφανίσουν. Οι πληροφορίες αυτές είναι απαραίτητες για τους ενδιαφερόμενους, γιατί τους βοηθούν στη λήψη αποφάσεων, κυρίως σχετικά με την απόκτηση υγιών απογόνων.
Παρ’ ότι η γενετική καθοδήγηση μπορεί να ζητήσουν όλοι οι υποψήφιοι γονείς, υπάρχουν ομάδες ατόμων οι οποίες είναι απαραίτητο να απευθυνθούν σε ειδικούς πριν προχωρήσουν στην απόκτηση απογόνων. Σ’ αυτές περιλαμβάνονται:
• Άτομα-φορείς γενετικών ασθενειών.
• Άτομα με οικογενειακό ιστορικό γενετικών ασθενειών.
• Γυναίκες ηλικίας 35 ετών και άνω.
• Γυναίκες με πολλαπλές αποβολές.
ΘΕΜΑ 3o
Α. Στα δοθέντα γενεαλογικά δένδρα μελετάται ο τρόπος κληρονόμησης κοινού μονογονιδιακού χαρακτηριστικού σε δύο διαφορετικές οικογένειες, συνεπώς πρόκειται για μονοϋβριδισμό.
Γνωρίζοντας τους φαινότυπους των ατόμων των δύο οικογενειών, θα βρούμε τον τρόπο κληρονόμησης του χαρακτηριστικού που μελετάται.
Εξετάζουμε περιπτώσεις:
α. Αν το γονίδιο που ελέγχει το υπό μελέτη χαρακτηριστικό είναι φυλοσύνδετο και υπολειπόμενο, τότε: Έστω ο γενετικός τόπος του φυλετικού χρωμοσώματος Χ – για τον οποίο δεν υπάρχει αντίστοιχος στο Υ φυλετικό χρωμόσωμα – στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα.
Το γονίδιο Α διαθέτει δύο αλληλόμορφα τα Α και α. Το αλληλόμορφο Α είναι το επικρατές ενώ το αλληλόμορφο α είναι το υπολειπόμενο και η παρουσία του σε ένα αρσενικό άτομο συνεπάγεται και τη φαινοτυπική παρουσία του χαρακτηριστικού. Η παρουσία του αλληλόμορφου α σε ομόζυγη κατάσταση στο θηλυκό άτομο επίσης συνεπάγεται τη φαινοτυπική έκφραση του χαρκτηριστικού που μελετάμε. Αντίθετα, αρσενικά άτομα με γονότυπο ΧΑΥ και θηλυκά άτομα με γονότυπο ΧΑΧΑ ή ΧΑΧα δεν εμφανίζουν το χαρακτηριστικό.
Από τα γενεαλογικά δένδρα που δίνονται, το χαρακτηριστικό αποκλείεται να κληρονομείται με φυλοσύνδετο υπολειπόμενο πρότυπο κληρονομικότητας, διότι είναι αδύνατο από τη διασταύρωση Ι1 (ΧΑΥ) x Ι2 (ΧαΧα) του πρώτου γενεαλογικού δένδρου να προκύψει ο απόγονος Ι3 (ΧαΧα) καθώς κάθε απόγονος κληρονομεί ένα πλήρες απλοειδές γονιδίωμα από κάθε γονέα του. Συνεπώς, το άτομο ΙΙ3 θα έπερεπε να μη φέρει το χαρακτηριστικό, διότι θα κληρονομούσε υποχρεωτικά το φυλετικό χρωμόσωμα ΧΑ του πατέρα του εφόσον το ατομο ΙΙ3 είναι θηλυκό άτομο.
β. Αν το γονίδιο που ελέγχει το χαρακτηριστικό που μελετάμε είναι αυτοσωμικό τότε:
i) Αν είναι επικρατές, θα έχουμε: Έστω ο γενετικός τόπος ενός ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα. Το γονίδιο Α διαθέτει δύο αλληλόμορφα τα Α και α, με σχέση επικράτειας μεταξύ τους το Α επικρατές του α. Άτομα με γονότυπο ΑΑ ή Αα εμφανίζουν το χαρακτηριστικό ενώ άτομα με γονότυπο αα δεν το εμφανίζουν.
Από τα δοθέντα γενεαλογικά δένδρα το χαρακτηριστικό αποκλείεται να κληρονομείται ως αυτοσωμικό επικρατές, διότι από τη διασταύρωση Ι1 (αα) x Ι2 (αα) του δεύτερου γενεαλογικού δένδρου είναι αδύνατο να προκύψουν οι απόγονοι ΙΙ2 (Αα ή ΑΑ) και ΙΙ3 (Αα ή ΑΑ).
Συνεπώς το χαρακτηριστικό δεν κληρονομείται ως αυτοσωμικό επικρατές.
ii) Αν είναι υπολειπόμενο, θα έχουμε: Έστω ο γενετικός τόπος ενός ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων στον οποίο εδράζεται το γονίδιο Α που ελέγχει τον υπό μελέτη χαρακτήρα. Το αλληλόμορφο Α του γονιδίου Α είναι επικρατές και η παρουσία του στο γονότυπο ενός ατόμου αποκλείει την εμφάνιση του χαρακτηριστικού. Το αλληλόμορφο α του γονιδίου Α είναι το υπολειπόμενο και η παρουσία του σε ομόζυγη κατάσταση στο γονότυπο ενός ατόμου συνεπάγεται τη φαινοτυπική έκφραση του χαρακτηριστικού. Δηλαδή άτομα με γονότυπο ΑΑ ή Αα δεν εμφανίζουν το χαρακτηριστικό ενώ άτομα με γονότυπο αα εμφανίζουν το χαρακτηριστικό.
Από τα δοθέντα γενεαλογικά δένδρα προκύπτει ότι το χαρακτηριστικό ακολουθεί αυτοσωμικό υπολειπόμενο τύπο κληρονομικότητας καθώς αυτός ο τύπος κληρονομικότητας επιβεβαιώνεται από όλες τις διασταυρώσεις των δύο γενεαλογικών δένδρων.
Συνεπώς το υπό εξέταση χαρακτηριστικό ακολουθεί αυτοσωμικό υπολειπόμενο τρόπο κληρονόμησης.
Από τα γενεαλογικά δένδρα που δίνονται έχουμε τους γονότυπους των ατόμων των δύο οικογενειών.
Γενεαλογικό δένδρο 1 (οικογένεια 1):
Ι1: Αα, καθώς δε φέρει το χαρακτηριστικό, αλλά αποκτά απογόνους που το φέρουν.
Ι2: αα, φέρει το χαρακτηριστικό.
ΙΙ1: Αα, το αλληλομορφο Α από τον πατέρα του (Ι1) και το αλληλομορφο α από τη μητέρα του (Ι2).
ΙΙ2: αα, φέρει το χαρακτηριστικό.
ΙΙ3: αα, φέρει το χαρακτηριστικό.
Γενεαλογικό δένδρο 2 (οικογένεια 2):
Ι1: Αα, δε φέρει το χαρακτηριστικό, αλλά αποκτά απογόνους που το φέρουν.
Ι2: Αα, ομοίως με Ι1.
ΙΙ1: ΑΑ (με πιθανότητα __ 13) ή Αα (με πιθανότητα _2_3), εφόσον δε φέρει το χαρακτηριστικό και έχει ετερόζυγους γονείς.
ΙΙ2: αα, φέρει το χαρακτηριστικό.
ΙΙ3: αα, φέρει το χαρακτηριστικό.
Οι παραπάνω γονότυποι προκύπτουν εύκολα από τα παρακάτω αβάκια του Punnett. Σε κάθε αβάκιο απεικονίζονται διαγραμματικά οι γαμέτες της κάθε διασταύρωσης και ο τρόπος συνδυασμού τους.
Ρ1: ♂ Αα (Ι1) x ♀ αα (Ι2)
Γαμέτες: Α, α / α, α
♂ / ♀ α α
Α Αα (ΙΙ1) Αα (ΙΙ1)
α αα (ΙΙ2) αα (ΙΙ3)
F1: Αα : αα γονοτυπική αναλογία
[Α] : [α] φαινοτυπική αναλογία
Αν το άτομο Ι1 είχε γονότυπο ΑΑ τότε όλοι οι απόγονοί του με το άτομο Ι2 θα είχαν γονότυπο Αα και δεν θα έφεραν το χαρακτηριστικό αυτό φαινοτυπικά.
Ρ2: ♂ Αα (Ι1) x ♀ Αα (Ι2)
Γαμέτες: Α, α / Α, α
♂ / ♀ Α α
Α ΑΑ (ΙΙ1) Αα (ΙΙ1)
α Αα (ΙΙ1) αα (ΙΙ2, ΙΙ3)
F1: ΑΑ : 2 Αα : αα γονοτυπική αναλογία
3[Α] : [α] φαινοτυπική αναλογία
Εφόσον το άτομο ΙΙ1 δεν φέρει το χαρακτηριστικό, θα έχει γονότυπο είτε ΑΑ είτε Αα, Με βάση το αβάκιο του Punnett που δίνεται παραπάνω, η πιθανότητα να έχει τον πρώτο από τους πιθανούς γονότυπους είναι __ 13, ενώ για τον δεύτερο πιθανό γονότυπο, η πιθανότητα είναι __ 23.
Εάν ένας τουλάχιστον από του γονείς της Ρ2 διασταύρωσης είχε γονότυπο ΑΑ, τότε θα ήταν αδύνατο να προκύψουν οι απόγονοι ΙΙ2 και ΙΙ3 με γονότυπο αα, ώστε να εμφανίζουν το χαρακτηριστικό.
Β. Οι μεταλλάξεις που αφορούν μεγάλες σε έκταση αλλαγές στην ακολουθία και στον αριθμό των βάσεων στο γονιδίωμα ενός οργανισμού αποτελούν τις χρωμοσωμικές ανωμαλίες. Οι αλλαγές στον αριθμό των χρωμοσωμάτων ονομάζονται αριθμητικές χρωμοσωμικές ανωμαλίες και έχουν ως αποτέλεσμα την τροποποίηση του φαινότυπου του ατόμου, εφόσον επιζήσει. Τα άτομα που έχουν περίσσεια ή ελλειψη μικρού αριθμού χρωμοσωμάτων ονομάζονται ανευπλοειδή. Η απουσία ενός μόνο χρωμοσώματος – αυτοσωμικού ή φυλετικού – ονομάζεται μονοσωμία.
Εφόσον οι γονείς έχουν φυσιολογικό αριθμό και μέγεθος χρωμοσωμάτων θα διαθέτουν, η μεν γυναίκα 22 αυτοσωμικά (Α) και 2 φυλετικά (Χ), ο δε άνδρας 22 αυτοσωμικά (Α) και ένα ζεύγος φυλετικών Χ, Υ χρωμοσωμάτων.
Τα ανευπλοειδή άτομα με έλλειψη μικρού αριθμού χρωμοσωμάτων, όπως αυτά με σύνδρομο Turner (ΧΟ) φέρουν 22 αυτοσωμικά και ένα φυλετικό Χ χρωμόσωμα προκύπτουν συνήθως λόγω του μη φυσιολογικού διαχωρισμού χρωμοσωμάτων κατά τη μείωση και είναι η μοναδική περίπτωση μονοσωμίας που επιζεί στον άνθρωπο.
Ειδικότερα ενας πιθανός μηχανισμός που μπορει να εξηγήσει τη γέννηση ενός παιδιού με μονοσωμία ως προς το φυλετικό χρωμόσωμα (44Α + ΧΟ), αφορα τη μείωση σε κάποιον από τους δύο γονείς και είναι για παράδειγμα:
Να μην αποχωριστούν τα φυλετικά χρωμοσώματα κατά τη μείωση Ι στη γυναίκα. Επομένως στο ένα θυγατρικό κύτταρο της μείωσης Ι θα υπάρχει φυσιολογικός αριθμός αυτοσωμικών χρωμοσωμάτων και τα δύο Χ φυλετικά χρωμοσώματα, ενώ στο άλλο θυγατρικό κύτταρο θα υπάρχει φυσιολογικός αριθμός αυτοσωμικών χρωμοσωμάτων και κανένα φυλετικό Χ χρωμόσωμα. Έτσι μετά το τέλος της μείωσης προκύπτουν γαμέτες που περιέχουν 22 αυτοσωμικά και δύο Χ φυλετικά χρωμοσώματα και γαμέτες που δεν περιέχουν κανένα Χ φυλετικό χρωμόσωμα αλλά έχουν 22 αυτοσωμικά χρωμοσώματα.
Αν ο γαμέτης που δεν έχει κανένα φυλετικό χρωμόσωμα γονιμοποιηθεί από ένα φυσιολογικό σπερματοζωάριο που έχει το Χ φυλετικό χρωμόσωμα, προκύπτει ζυγωτό 44Α + ΧΟ, δηλαδή άτομο με σύνδρομο Turner.
Λάθος μειωτική διαίρεση για το σχηματισμό Turner
Σημείωση: Τέκνο με σύνδρομο Turner (μονοσωμία στα φυλετικά χρωμοσώματα του ανθρώπου) μπορεί να προκύψει από φυσιολογικούς γονείς και με άλλους πιθανούς τρόπους [Βλέπε απαντήσεις 2004, θέμα 3ο(1)].
Τα άτομα με σύνδρομο Turner εμφανίζουν συγκεκριμένο και χαρακτηριστικό φαινότυπο (είναι θηλικού γένους αλλά δεν εμφανίζουν τα δευτερογενή χαρακτηριστικά του φύλου και είναι στείρα), οπότε και η διάγνωση του συνδρόμου είναι εύκολη από τα εξωτερικά φαινοτυπικά χαρακτηριστικά του ατόμου. Στην περίπτωση όμως, που θέλουμε να μελετήσουμε τα χρωμοσώματα ενός ατόμου με αυτό το σύνδρομο μετά τη γέννησή του, είναι απαραίτητη η καρυοτυπική απεικόνισή τους και η παρατηρησή τους στο μικροσκόπιο.
Η μελέτη των χρωμοσωμάτων είναι δυνατή μόνο σε κύτταρα τα οποία διαιρούνται. Τα κύτταρα αυτά μπορεί να προέρχονται είτε από ιστούς που διαιρούνται φυσιολογικά είτε από κυτταροκαλλιέργειες, όπου γίνεται in vitro επαγωγή της διαίρεσης με ουσίες που έχουν μιτογόνο δράση. Τα κύτταρα που θα χρησιμοποιηθούν πρέπει να μπορούν να αφαιρεθούν εύκολα και ανώδυνα από το σώμα του ατόμου. Τέτοια κύτταρα είναι τα λευκά αιμοσφαίρια του αίματος. Το αίμα αφαιρείται από το σώμα του ατόμου με απλή αιμοληψία και τα λευκά αιμοσφαίρια, σε αντίθεση με τα ερυθρά αιμοσφαίρια, είναι εμπύρηνα και διαιρούνται. Τα χρωμοσώματα μελετώνται στο στάδιο της μετάφασης, όπου εμφανίζουν το μεγαλύτερο βαθμό συσπείρωσης και είναι ευδιάκριτα ως μεμονομένες δομές στο οπτικό μικροσκόπιο. Επειδή σε ένα πληθυσμό διαιρούμενων κυττάρων το ποσοστό αυτών που βρίσκονται στη μετάφαση είναι μικρό, χρησιμοποιούνται ουσίες, οι οποίες σταματούν την κυτταρική διαίρεση στη φάση αυτή. Στη συνέχεια, τα κύτταρα επωάζονται σε υποτονικό διάλυμα, ώστε να σπάσει η κυτταρική τους μεμβράνη και τα χρωμοσώματά τους απλώνονται σε αντικειμενοφόρο πλάκα. Τέλος, χρωματίζονται με ειδικές χρωστικές ουσίες και παρατηρούνται στο μικροσκόπιο.
Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος. Η απεικόνιση αυτή αποτελεί τον καρυότυπο. Κατά την παρατήρηση του καρυότυπου, η παρουσία 45 χρωμοσωμάτων, 44 αυτοσωμικών και ενός φυλετικού Χ χρωμοσώματος μας οδηγεί στο συμπέρασμα ότι πρόκειται για άτομο με το σύνδρομο Turner.
ΘΕΜΑ 4o
α. Στους ευκαρυωτικούς οργανισμούς, σε αντίθεση με τους προκαρυωτικούς, το mRNA που παράγεται κατά τη μεταγραφή ενός γονιδίου συνήθως δεν είναι έτοιμο να μεταφραστεί αλλά υφίσταται μια πολύπλοκη διαδικασία ωρίμανσης. Η ανακάλυψη αυτής της διαδικασίας οδήγησε στο συμπέρασμα ότι τα περισσότερα γονίδια των ευκαρυωτικών οργανισμών (και των ιών που τους προσβάλλουν) είναι ασυνεχή ή διακεκομμένα. Δηλαδή, η αλληλουχία που μεταφράζεται σε αμινοξέα διακόπτεται από ενδιάμεσες αλληλουχίες, οι οποίες δε μεταφράζονται σε αμινοξέα. Οι αλληλουχίες που μεταφράζονται σε αμινοξέα ονομάζονται εξώνια και οι ενδιάμεσες αλληλουχίες ονομάζονται εσώνια.
β. Το DNA των οργανισμών είναι δίκλωνο μόριο, κάθε κλώνος του είναι μια πολυνουκλεοτιδική αλυσίδα και οι δύο αλυσίδες που το συνιστούν έχουν αντιπαράλληλο προσανατολισμό. Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με 3΄→ 5΄ φωσφοδιεστερικό δεσμό, που είναι ένας ομοιοπολικός δεσμός. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3΄ άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που βρίσκεται συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται η πολυνουκλεοτιδική αλυσίδα, το πρώτο της νουκλεοτίδιο έχει πάντα μια ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5΄ άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο έχει ελεύθερο το υδροξύλιο του 3΄ άνθρακα της πεντόζης του. Γι’ αυτό ο προσανατολισμός της πολυνουκλεοτιδικής αλυσίδας είναι 5΄→3΄.
Στο τμήμα του μορίου DNA που δίνεται προσδιορίζεται ότι το δεξί άκρο της επάνω αλυσίδας του φέρει ελεύθερο υδροξύλιο, συνεπώς αυτό αποτελεί το 3΄ άκρο του, κατά συνέπεια τα 3΄ και 5΄ άκρα του δοσμένου μορίου DNA φαίνονται παρακάτω:
5 ΄… GA AGGAGGTTGCTTA AGGGGCCCTACCA AT …3 ΄
3 ΄ … CTTCCTCCA ACGA ATTCCCCGGGATGGTTA …5 ΄
γ. Πρόδρομο mRNA: 5΄ … GAAGGAGGUUGCUUAAGGGGCCCUACCAAU … 3΄
Ώριμο mRNA: 5΄ … GAAGGAGGUUGCUUAACUACCAAU … 3΄
δ. Όταν ένα γονίδιο που περιέχει εσώνια μεταγράφεται, δημιουργείται το πρόδρομο mRNA που περιέχει και εξώνια και εσώνια. Το πρόδρομο mRNA μετετρέπεται σε ώριμο mRNA με τη διαδικασία της ωρίμανσης, κατά την οποία τα εσώνια κόβονται από μικρά ριβονουκλεοπρωτεϊνικά «σωματίδια» και απομακρύνονται. Τα ριβονουκλεοπρωτεϊνικά σωματίδια αποτελούνται από snRNA και από πρωτεΐνες και λειτουργούν ως ένζυμα: κόβουν τα εσώνια και συρράπτουν τα εξώνια μεταξύ τους. Έτσι σχηματίζεται το «ώριμο» mRNA. Αυτό, παρ’ ότι αποτελείται αποκλειστικά από εξώνια, έχει δύο περιοχές που δε μεταφράζονται σε αμινοξέα. Η μία βρίσκεται στο 5΄ άκρο και η άλλη στο 3΄ άκρο. Οι αλληλουχίες αυτές ονομάζονται 5΄ και 3΄ αμετάφραστες περιοχές, αντίστοιχα. Το mRNA μεταφέρεται από τον πυρήνα στο κυτταρόπλασμα και ειδικότερα στα ριβοσώματα όπου είναι η θέση της πρωτεϊνοσύνθεσης.
ε. Οι περιοριστικές ενδονουκλεάσες αναγνωρίζουν ειδικές αλληλουχίες δίκλωνου DNA, μήκους 4-8 νουκλεοτιδίων. Τα ένζυμα αυτά κόβουν το δίκλωνο DNA σε ειδικές θέσεις αφήνοντας μονόκλωνα άκρα από αζευγάρωτες βάσεις στα κομμένα άκρα.
Στο δοσμένο τμήμα DNA δεν υπάρχει η αλληλουχία αναγνώρισης της περιοριστικής ενδονουκλεάσης EcoRI με κατεύθυνση 5΄→3΄, συνεπώς το συγκεκριμένο περιοριστικό ένζυμο δεν μπορεί να κόψει το δοθέν τμήμα DNA.
Η αλληλουχία αναγνώρισης της EcoRI είναι η:
5΄…G A A T T C…3΄
3΄…C T T A A G…5΄
στ. Η γενετική πληροφορία υπάρχει σε τμήματα του DNA με συγκεκριμένη ακολουθία, τα γονίδια. Αυτά, διαμέσου της μεταγραφής και της μετάφρασης καθορίζουν τη σειρά των αμινοξέων στην πρωτεΐνη. Τα γονίδια διακρίνονται σε δύο κατηγορίες:
– Στα γονίδια που μεταγράφονται σε mRNA και μεταφράζονται στη συνέχεια σε πρωτεΐνες και
– Στα γονίδια που μεταγράφονται και παράγουν tRNA, rRNA και snRNA (μόνο στα ευκαρυωτικά κύτταρα).
Δηλαδη υπάρχουν τέσσερα είδη μορίων RNA που παράγονται με τη μεταγραφή ευκαρυωτικών γονιδίων: το αγγελιοφόρο RNA (mRNA), το μεταφορικό RNA (tRNA), το ριβοσωμικό RNA (rRNA) και το μικρό πυρηνικό RNA (snRNA).
Όλα τα κύτταρα ενός πολυκύτταρου οργανισμού έχουν το ίδιο DNA. Μολονότι όλα τα κύτταρα έχουν τις ίδιες γενετικές οδηγίες, έχουν αναπτύξει μηχανισμούς που τους επιτρέπουν να εκφραζουν τη γενετική τους πληροφορία επιλεκτικά και να ακολουθούν μόνο τις οδηγίες που χρειάζονται κάθε χρονική στιγμή. Τα κύτταρα λοιπόν ενός πολύπλοκου πολυκύτταρου οργανισμού, όπως τα νευρικά, τα μυϊκά, τα ηπατικά, διαφέρουν στη μορφή και στη λειτουργία τους, αλλά έχουν όλα το ίδιο γενετικό υλικό, άρα και τα ίδια γονίδια. Στους ανώτερους ευκαρυωτικούς οργανισμούς πολλά γονίδια εκφράζονται μόνο σε συγκεκριμένους τύπους κυττάρων, όπως τα γονίδια των αλυσίδων των αιμοσφαιρινών που εκφράζονται μόνο στα πρόδρομα ερυθρά αιμοσφαίρια.
Αν θέλουμε να κλωνοποιήσουμε μόνο τα γονίδια που εκφράζονται σε συγκεκριμένα κύτταρα, τότε κατασκευάζουμε cDNA-βιβλιοθήκες. Οι cDNA βιβλιοθήκες περιέχουν αντίγραφα των mRNA όλων των γονιδίων που εκφράζονται στα κύτταρα αυτά μια συγκεκριμένη χρονική στιγμή και επιπλέον έχουν το πλεονέκτημα απομόνωσης μόνο των αλληλουχιών των γονιδίων που μεταφράζονται σε αμινοξέα, δηλαδή των εξωνίων.
Για να κατασκευάσουμε μια cDNA βιβλιοθήκη, αρχικά απομονώνουμε το συνολικό ώριμο mRNA από τα κύτταρα του ιστού στον οποίο εκφράζεται το γονίδιο που μας ενδιαφέρει. Το mRNA χρησιμοποιείται σαν καλούπι για τη σύνθεση μιας συμπληρωματικής αλυσίδας DNA (cDNA: complementary DNA). Με κατάλληλες τεχνικές το αποτέλεσμα είναι η δημιουργία δίκλωνων μορίων DNA που εισάγονται σε πλασμίδια ή βακτηριοφάγους και κλωνοποιούνται.
Συνεπώς δεν κλωνοποιούνται σε cDNA βιβλιοθήκη οι παρακάτω κατηγορίες των γονιδίων που υπάρχουν στο χρωμοσωμικό DNA ενός κυτταρικού τύπου ενός πολυκύτταρου ευκαρυωτικού οργανισμού:
• Τα γονίδια που κωδικοποιούν για rRNA, snRNA, tRNA.
• Τα γονίδια που κωδικοποιούν για κάποια πολυπεπτιδική αλυσίδα, αλλά σε αυτόν τον κυτταρικό τύπο δε συντίθεται αυτή η πολυπεπτιδική αλυσίδα.
• Τα γονίδια που κωδικοποιούν για κάποια πολυπεπτιδική αλυσίδα που είναι απαραίτητη στο συγκεκριμένο κυτταρικό τύπο, αλλά τη δεδομένη χρονική στιγμή που πραγματοποιείται η διαδικασία κατασκευής cDNA βιβλιοθήκης του συγκεκριμένου κυτταρικού τύπου, το γονίδιο που κωδικοποιεί αυτή η πολυπεπτιδική αλυσίδα δεν εκφράζεται, είτε γιατί το κύτταρο διαθέτει επαρκή ποσότητα από αυτή την πολυπεπτιδική αλυσίδα είτε γιατί δε συντρέχουν οι απαραίτητες προΰποθέσεις (κατάλληλο ερέθισμα, περιβάλλον) για την έκφραση του συγκεκριμένου γονιδίου.

Advertisements

Στο ιστολόγιο (Blog) αυτό θα δημοσιεύονται άρθρα – απόψεις της συγγραφέα σχετικά με τη διδασκαλία της Bιολογίας και της Χημείας, ασκήσεις καθώς και οτιδήποτε μπορεί να ενδιαφέρει έναν υποψήφιο για εισαγωγή στο πανεπιστήμιο και έχει επιλέξει την ομάδα Θετικού Προσανατολισμού καθώς όσους υποψηφίους έχουν επιλέξει το μάθημα της Βιολογίας γενικής παιδείας