Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

Α. Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                                                  Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρίων. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρνών  στο έμβρυο. (7)

  1. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)
  2. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία του γονιδίου β των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως , ακριβώς πριν από την έναρξη των 95 νουκλοτιδίων; (2)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1)

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (2)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (2)

2.

α. Σε ένα άτομο πάρθηκαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥ+44. Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (5)

β. Εξηγήστε αν είναι δυνατόν να προκύψουν μονοζυγωτικά δίδυμα διαφορετικού φύλου.(5)

 

 Ζήτημα 4ο                                                                                                                  Μονάδες 25

 

Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής ανομίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

Α. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

Γ. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

Δ. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

Ε. Πιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

ΣΤ. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Διαγώνισμα Προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2017

Ζήτημα.                                                                                                                         μονάδες 25

1.Τα χρωμοσώματα των ευκαρυωτικών οργανισμών είναι ουδέτερα τόσο χημικά όσο και ηλεκτρικά, αυτό σημαίνει ότι:

Α. οι ιστόνες είναι θετικά φορτισμένες και όξινες

Β. οι ιστόνες είναι αρνητικά φορτισμένες και όξινες

Γ. οι ιστόνες είναι θετικά φορτισμένες και βασικές

Δ. οι ιστόνες είναι αρνητικά φορτισμένες και βασικές

Ε. τίποτα από τα παραπάνω

Στ. όλα τα παραπάνω είναι δυνατά.

2. Στο εργαστήριο απομονώθηκαν παγκρεατικά κύτταρα και μυικά  κύτταρα ποντικού. Μέτα από κατάλληλα πειράματα προέκυψαν υβριδικά κύτταρα, στα οποία όταν δημιουργήθηκε η cDNA βιβλιοθήκη τους σε δυο διαφορετικές χρονικές στιγμές, πήραμε ώριμα mRNA που κωδικοποιούν  για ινσουλίνη και ώριμα mRNA που κωδικοποιούν για μυοσίνη την πρώτη φορά και ώριμα mRNA που κωδικοποιούν  κατά κύριο λόγο μόνο μυοσινη τη δεύτερη φορά.

Α. Τα υβριδικά κύτταρα μπορεί να προέκυψαν από την σύντηξη πυρήνων.

Β. τα υβριδικά κύτταρα μπορεί να προέκυψαν από απομάκρυνση του πυρήνα του παγκρεατικού πυρήνα και τοποθέτηση του πυρήνα του μυϊκού κυττάρου στο απύρηνο παγκρεατικό κύτταρο.

Γ. τα υβριδικά κύτταρα μπορεί να προέκυψαν από μεταφορά πρωτεϊνών μυϊκών κυττάρων σε παγκρεατικά.

Δ. τα υβριδικά κύτταρα εκφράζουν τα ίδια γονίδια κάθε χρονική στιγμή

Ε. το α ή το β

Στ. το γ ή το δ.

3. Δημιουργήθηκε ένας σύνθετος βακτηριοφάγος με πρωτεϊνικό καψίδιο του Τ4 και γενετικό υλικό του λ φάγου. Οι σύνθετοι αυτοί ιοί χρησιμοποιήθηκαν για την δημιουργία γονιδιωματικής βιβλιοθήκης του βακτηρίου A. tumefaciens. Η γονιδιωματική βιβλιοθήκη αποτελείται από:

Α. λ φάγους το DNA των οποίων είναι ανασυνδυασμένο με τμήμα από Ti πλασμίδιο και το χρωμόσωμα του βακτηρίου.

Β. Τ4 φάγους το γενετικό υλικό των οποίων είναι ανασυνδυασμένο με τμήματα από το ολικό DNA του βακτηρίου.

Γ. λ φάγους που φέρουν ανασυνδυασμένο γενετικό υλικό του Τ4 με τμήμα από το DNA του βακτηρίου δότη.

Δ. Τ4 φάγους και λ φάγους ο κάθε ιός με το δικό του DNA ανασυνδυασμένο με τμήμα από το γενετικό υλικό του βακτηρίου .

Ε. τίποτα από τα παραπάνω.

Στ. οποιοδήποτε από τα παραπάνω είναι μπορεί να είναι σωστό.

4. Δίνεται το ολιγόπεπτιδίο :

met-lys-pro-arg-ser-arg-ile-phe-glu-met

Το συνεχές γονίδιο που το κωδικοποιεί πέπτεται από την EcoRI. To μεταφράσιμο τμήμα της κωδικής αλυσίδας είναι:

Α. 5’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG3’

B  5.’ ATG-GAA-TTC-ATT-AGG-TCC-AGG-CCC-AAA-ATG3’

Γ. 5’ ATG-AAG-CTT-TTA-GGA-CCT-GGA-CCC-AAA-ATG3’

Δ. 3’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG5’

E. καμιά από τις παραπάνω επιλογές.

Στ. οποιαδήποτε από τις παραπάνω επιλογές.

5. Τα αντισώματα είναι πρωτεΐνες με τεταρτοταγή δομή αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δυο όμοιες. Δυο βαριές και δυο ελαφριές. Τα μη μονοκλωνικά αντισώματα είναι διαφορετικά μεταξύ τους μόνο σε ένα μικρό ακραίο τμήμα τόσο των βαρίων όσο και των ελαφριών αλυσίδων τους. Ο ανθρωπινός οργανισμός μπορεί να συνθέσει εκατομμύρια διαφορετικά αντισώματα. Τα μονοκλωνικά αντισώματα παράγονται με τεχνολογία υβριδωμάτων και όχι με γενετική μηχανική από γενετικά τροποποιημένα βακτήρια ή ευκαρυωτικά κύτταρα, διότι:

α. είναι πιθανόν αδύνατη η απομόνωση των δυο διαφορετικών ωρίμων mRNA από ένα β λεμφοκύτταρο που απαιτούνται για την cDNA βιβλιοθήκη.

Β. είναι πιθανόν αδύνατη η εκτέλεση των πολύπλοκων μετά-μεταφραστικών τροποποιήσεων που απαιτούνται από τα βακτήρια καθώς και η in vitro εκτέλεση τους.

Γ. για να γίνει η απομόνωση ωρίμων mRNA πρέπει να γνωρίζουμε τα γονίδια που τα κωδικοποιούν και αυτά δεν είναι μέχρι σήμερα γνωστά.

Δ. τίποτα από τα παραπάνω.

Ζήτημα 2.                                                                                                                     Μονάδες 25 

1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA  που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης Α και το βάζουμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση πρόδρομων β αλυσίδων της αιμοσφαιρίνης Α;  (μονάδες 2)              Αιτιολογήστε την απάντηση σας. (μονάδες 5)

2. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA αν ο γενετικός κώδικας δεν ήταν καθολικός; (μονάδες 7)

3.  Δώστε τον ορισμό της βιοτεχνολογίας. (μονάδες 6)

4. Δίνεται ο παρακάτω πινάκας, να γίνουν οι σωστές αντιστοιχήσεις. (μονάδες 5)

2017 Προσομοίωση πίνακας

Ζήτημα 3.                                                                                                                        Μονάδες 25

Σε μια προσπάθεια γεωπόνων βιοτεχνολόγων για την παραγωγή άνθεων με εντονότερο χρώμα, το δίκλωνο DNA που κωδικοποιεί την συνθετάση της χαλκόνης (ένζυμο υπεύθυνο για την παραγωγή μοβ χρωστικής των άνθεων της πετούνιας), τέθηκε υπό τον έλεγχο του πολύ ισχυρού υποκινητή 35S του ιού της μωσαϊκωσης (ιογενής ασθένεια) της πετούνιας, ο οποίος είχε ενθεθεί στο Ti. Στη συνεχεία, με τη βοήθεια του Ti πλασμίδιου και του βακτηρίου A. tumefanciens, το γονίδιο της συνθετάσης, μαζί με τον υποκινητή του ιού μεταφέρθηκε σε φυτά πετούνιας μοβ χρώματος. Το πλασμίδιο Ti, περιείχε γονίδιο ανθεκτικότητας στην καναμυκινή, για την επιλογή των φυτών που δέχθηκαν το ανασυνδυασμένο Ti. Το Ti έφερε μια θέση αναγνώρισης για το περιοριστικό ένζυμο EcoRI εντός του γονιδίου της ανθεκτικότητας στην καναμυκίνη.

Η υπερέκφραση του ενζύμου της συνθετάσης της χαλκόνης στην πετούνια, είχε ως αποτέλεσμα, όχι απαραιτήτως την παραγωγή άνθεων με βαθύτερο χρώμα, όπως θα περιμέναμε, αλλά και φυτών που έφεραν λευκά άνθη. Για να διαπιστωθεί το πρότυπο της κληρονόμησης  του ετερόλογου γονιδίου, έγινε ανάδρομη διασταύρωση των λευκών διαγονιδιακών απόγονων με το πατρικό φυτό, που έφερε ομοιόμορφα μοβ άνθη. Παραγόταν φυτά μοβ με ποσοστό 50% και φυτά λευκά κατά 50%. Ενώ από την διασταύρωση φυτών με βαθύ μοβ χρώμα και φυσιολογικών μοβ πήραμε 50% φυσιολογικά και 50% διαγονιδιακά μοβ.

Σημείωση: θεωρούμε ότι κάθε κύτταρο λαμβάνει από ένα πλασμίδιο Τi.

α. Περιγράψτε την διαδικασία με την οποία οι επιστήμονες δημιούργησαν διαγονιδιακά φυτά πετούνιας ξεκινώντας από την δημιουργία cDNA βιβλιοθήκης. (μονάδες 10)

β. Για ποιο λόγο το δίκλωνο ετερόλογο γονίδιο τέθηκε υπό τον έλεγχο του υποκινητή 35S του ιού της μωσαϊκώσης της πετούνιας όταν ενθέθηκε στο Ti πλασμίδιο, για ποιο λόγο δεν επιλέχθηκε ο υποκινητής του γονιδίου της χαλκόνης; (μονάδες 5)

γ. Δώστε την ερμηνεία για την μη αναμενόμενη εμφάνιση φαινοτύπων στα διαγονιδιακά φυτά. (μονάδες 10)

Ζήτημα 4.                                                                                                                Μονάδες 25

Δίνεται το παρακάτω γενεαλογικό δένδρο το οποίο αφορά την κληρονόμηση δυο ασθενειών στον άνθρωπο. Την ασθένεια του υποφυσιακού νανισμού και την συνδυασμένη εγκεφαλομυοπάθεια.

2017 Προσομοίωση-02

Προκείμενου να βρεθεί ο τρόπος κληρονόμησης της συνδυασμένης εγκεφαλομυοπάθειας πάρθηκε μυϊκός ιστός από το άτομο ΙΙΙ6, στον οποίο πραγματοποιήθηκε βιοψία και μοριακές αναλύσεις. Γνωρίζουμε ότι σύμφωνα με τις βιοψίες η ασθένεια της μυοπάθειας δεν εμφανίζει κανένα από τα γνωστά πρότυπα, ωστόσο, εμφανίζει τροποποιημένα μιτοχόνδρια, έτσι έγινε PCR ενίσχυση και πέψη με περιοριστικές ενδονουκλεάσες για τα γονίδια ND1 και ND6 του mtDNA.

Το φυσιολογικό ND1 γονίδιο δεν πέπτεται από την EcoRI, ενώ το παθολογικό αλληλόμορφο πέπτεται σε ένα σημείο. Η ίδια περιοριστική ενδονουκλεάση πέπτει το φυσιολογικό ανθρωπινό mtDNA σε ένα ακόμη σημείο.

Το φυσιολογικό αλληλόμορφο ND6 του mtDNA, πέπτεται από την PstI, ενώ το παθολογικό αλληλόμορφο όχι.

Στο ακόλουθο σχήμα δίνεται ο χάρτης περιορισμού του ανθρώπινου mtDNA, το οποίο έχει μέγεθος 17.000 ζ.β.

Δίνεται η θέση αναγνώρισης της PstI:

5’ CTGCAG3’

3’ GACGTC5’

2017 Προσομοίωση-03

Πάρθηκαν δείγματα από τα εξής άτομα της γενεαλογίας :

Ι1, Ι2, ΙΙ1, ΙΙ3, ΙΙ5, ΙΙΙ5, ΙΙΙ6, ΙΙΙ7

To mtDNA, κάθε ατόμου πέπτεται με EcoRI και PstI, ταυτόχρονα και πήραμε τα ακόλουθα αποτελέσματα. Το κυκλικό μόριο δεν εμφανίζεται.

2017 Προσομοίωση-04

Από περαιτέρω γενετικές μελέτες που έγιναν αποκλείστηκε οποιαδήποτε σχέση αυτόσωμικών γονιδίων με την μυοπάθεια.

α.Με ποιο τρόπο κληρονομείται η ασθένεια του υποφυσιακού νανισμού σύμφωνα με το γενεαλογικό δένδρο ποια διασταύρωση αποδεικνύει αυτόν τον τρόπο κληρονόμησης;      ( μονάδες 2)

β. προτείνεται ένα τρόπο κληρονόμησης ή εμφάνισης της μυοπάθειας στο άτομο που εμφανίζει τη νόσο (μονάδες 8). Με ποια πιθανότητα ένα επόμενο παιδί των ΙΙ5 και ΙΙ6 θα νοσεί (μονάδες 2);

γ. Σχεδιάστε τον περιοριστικό χάρτη του mtDNA του ατόμου Ι1 και του ατόμου Ι2 (μονάδες 3).

δ.Εξηγήστε ποια είναι η κωδική και η μη κωδική αλυσίδα των γονιδίων ND1 και ND6. Να προσδιοριστεί ο προσανατολισμός των κλώνων των δυο γονιδίων (μονάδες 6).

2017 Προσομοίωση-05

ε.Τι είδους μετάλλαξη φέρει το παθολογικό γονίδιο ND1 (μονάδες 1).

στ. Προσδιορίστε τον προσανατολισμό του μορίου mtDNA του ανθρώπου στο σημείο Α (εκατέρωθεν αυτού) (μονάδες 1).

ζ.Οι ασθένειες που μελετώνται έχουν τις προϋποθέσεις για την θεραπεία τους μέσω γονιδιακής θεραπείας (μονάδες 2);

Διαγώνισμα κεφαλαίου 7 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1                                                                    μονάδες 25

A.Επιλέξτε την σωστή πρόταση:                                                        μόρια 15

1. Τα μικροβιακά κύτταρα για να διαιρεθούν :

1. Πρέπει να έχουν το κατάλληλο μέγεθος και αρκετή ενέργεια.

2. Πρέπει να έχουν ιδανικό περιβάλλον

3.Να έχει ολοκληρωθεί χρονικό διάστημα 20 λεπτών

4. Πρέπει να έχουν τον κατάλληλο ρυθμό ανάπτυξης

2. Όλα τα κύτταρα μια μικροβιακής καλλιέργειας διαιρούνται συγχρόνως.

Το βακτήριο Thermus aquaticus από το οποίο λαμβάνουμε την Taq DNA πολυμεράση που εκτελεί την αντιγραφή στο PCR, δεν μπορεί:

1.Να καλλιεργηθεί σε στερεό θρεπτικό υλικό

2.Να καλλιεργηθεί σε υγρό θρεπτικό υλικό

3.Να συντηρηθεί στους -80οC

4.Να επωαστεί σε κλίβανο

3. Η βιοτεχνολογία:

1.Ανακαλύφθηκε από τον Ούγγρο K. Ereky

2.Ανακαλύφθηκε από τον Γάλλο L. Pauster

3.Αναπτύχθηκε σημαντικά μετά την ανάπτυξη της Γενετικής Μηχανικής

4.Αφορά αποκλειστικά τους μικροοργανισμούς

4.Η απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής πραγματοποιήθηκε σε συνθήκες:

1.Θερμοκρασία 37 βαθμοί Κελσίου, pH=7, αερόβια

2.Θερμοκρασία 25 βαθμοί Κελσίου, pH=5,5, αερόβια

3.Θερμοκρασία 37 βαθμοί Κελσίου , pH=5,5, αναερόβια

4.Θερμοκρασία -80 βαθμοί Κελσίου, pH=7, αναερόβια

5.Το βακτήριο E. coli διαιρείται κάθε 20’ σε μια καλλιέργεια, ο μέγιστος πληθυσμός είναι χ κύτταρα και μετά από 3 ώρες καλλιέργειας ο πληθυσμός βρίσκεται στην εκθετική με χ/2 πλήθος κυττάρων, πόσο χρόνο χρειάζεται ακόμη η καλλιέργεια για να επιτύχει τον μέγιστο πληθυσμό;

1.Χ’

2.20’

3.3 ώρες

4.χ/2 ώρες

 

Ερωτήσεις σωστού- λάθους: μόρια 10

  1. Τα βακτήρια και οι μονοκύτταροι ευκαρυώτες διαιρούμενα πολλαπλασιάζονται.
  2. Οι ανεξαιρέτως οι μικροοργανισμοί χρειάζονται C, H, O, N, P, S.
  3. Η στερεή καλλιέργεια εμφανίζει λανθάνουσα εκθετική, στατική και φάση θανάτου.
  4. Η στερεή καλλιέργεια αποτελείται από αποικίες ενώ η υγρή αποτελείται από ανεξάρτητα αιωρούμενα κύτταρα.
  5. Όλοι οι μικροοργανισμοί χρειάζονται τα ίδια μίκρο και ιχνοστοιχεία σε διαφορετικές όμως συγκεντρώσεις, αναλόγως με την σύσταση και την λειτουργία των κυττάρων τους.
  6. Τα αυτότροφα μικρόβια απορροφούν ανόργανο C και τον μετατρέπουν σε οργανικές ενώσεις
  7. Οι αναερόβιοι μικροοργανισμοί δεν μπορούν να καλλιεργηθούν σε στέρεες καλλιέργειες.
  8. Τα αντιβιοτικά παράγονται κατά την στατική φάση από μη γενετικώς τροποποιημένα βακτήρια, κυρίως και χρησιμοποιούνται στην ιατρική για να σκοτώσουν άλλα μικρόβια.
  9. Σε μια συνεχή καλλιέργεια το περιβάλλον ανάπτυξης των μικροβίων στο βιοαντιδραστήρα είναι πάντα ιδανικό.
  10. Τα κύτταρα που εκτελούν ζύμωση, εκτελούν αναερόβιο μεταβολισμό, η ζύμωση όμως για μια καλλιέργεια μικροβίων είναι η υγρή ή η στερεή καλλιέργεια τους.

Ζήτημα 2                                                                         μονάδες 25

1.Δίνεται το παρακάτω τρυβλίο με δύο διαφορετικές αποικίες του βακτηρίου D. Pneumoniae.

Διαγώνισμα Κεφ 7 blog-01

α. Ποια αποικία αφορά ποιο από τα δυο διαφορετικά στελέχη του υπό μελέτη βακτηρίου;

β. Εξηγήστε που οφείλεται αυτή η διαφορά των δυο στελεχών του ίδιου είδους μικροοργανισμών.

γ. Ποιο από τα δυο είδη θα είχε κατά την γνώμη σας μεγαλύτερα ποσοστά επιτυχίας κατά την   in vitro  διαδικασία μετασχηματισμού για την πρόσληψη πλασμιδιακού φορέα κλωνοποίησης;

δ. Εξηγήστε την απάντηση σας.                            μόρια (1,1,1,1,2) 5

2.Δίνονται παρακάτω τα βήματα που απαιτούνται για την εργαστηριακής κλίμακας στερεή καλλιέργεια ενός είδους μικροοργανισμού.

Τοποθετήστε τα στην σωστή σειρά.

  1. Επώαση σε κλίβανο
  2. παρασκευή κατάλληλου για τον μικροοργανισμό υγρού θρεπτικού υλικού
  3. απομόνωση μικροοργανισμών από το φυσικό του ενδιαίτημα
  4. εμβολιασμός του θρεπτικού υλικού
  5. διατήρηση της καλλιέργειας για μακρό χρονικό διάστημα στους -80 βαθμούς Κελσίου
  6. προσθήκη άγαρ
  7. ρύθμιση pH του θρεπτικού υλικού
  8. αποστείρωση του υλικού ανάπτυξης (μόρια 8)

3. Ποιες είναι οι συνθήκες που πρέπει να ελέγχονται για την ανάπτυξη μικροοργανισμών σε βιοαντιδραστήρες; (μόρια 4)

Για ποιο λόγο είναι απαραίτητη η διασφάλιση συνθηκών ασηψίας; (μόρια 3)

4. Ποια από τις παρακάτω καμπύλες δεικνύει την συνάρτηση N=f(t), όπου Ν ο πληθυσμός των μικροβιακών κυττάρων σε μια συνεχή καλλιέργεια  ; μόρια 1

Διαγώνισμα Κεφ 7 blog-02

Αιτιολογήστε την απάντησή σας. (μόρια 4)

 

Ζήτημα 3                                                                         μονάδες 25

Δίνεται το παρακάτω διάγραμμα dN/dt=f(t), το οποίο περιγράφει τη μεταβολή της ταχύτητας ανάπτυξης ενός μικροβιακού πληθυσμού σε συνάρτηση με τον χρόνο.

Διαγώνισμα Κεφ 7 blog-03

Εξηγήστε:

Αν η καλλιέργεια είναι υγρή ή στερεή, κλειστή ή συνεχής. (μόρια 6)

2. Δώστε μια εξήγηση γιατί ένα βακτήριο που φυσιολογικά απομονώνεται από το έδαφος στο επίπεδο της ριζόσφαιρας (θέση ανάπτυξης ριζών των φυτών, όπου υπάρχει περιορισμένη συγκέντρωση οξυγόνου), δεν μπορεί να αναπτυχθεί ικανοποιητικά στο εναέριο περιβάλλον. (μόρια 6)

Τα κύτταρα μιας αποικίας εκφράζουν όλα τα ίδια γονίδια;

Αιτιολογήστε την απάντηση σας. (μόρια 2 και 5)

4. Σε ένα μικροβιακό πληθυσμό που βρίσκεται στην εκθετική φάση μιας κλειστής καλλιέργειας όλα τα κύτταρα βρίσκονται σε αυτή τη φάση και κανένα δεν βρίσκεται σε διαφορετική φάση; Αιτιολογήστε την απάντηση σας.  (μόρια 2 και 4)

 

Ζήτημα 4                                                                         μονάδες 25

Στο παρακάτω γράφημα παρουσιάζεται η διακύμανση του πλήθους ενός βακτηριακού είδους. Για το είδος αυτό θέλουμε να μελετήσουμε την ανθεκτικότητα του σε δυο διαφορετικά αντιβιοτικά, την νεομυκίνη (Νeo) και την χλωραφαινικόλη (Chl), σε δυο διαφορετικές συγκεντρώσεις για το καθένα. Γνωρίζουμε ακόμη ότι το βακτηριακό αυτό είδος σε υψηλή θερμοκρασία θανατώνεται.

Διαγώνισμα Κεφ 7 blog-04

Το βακτηριακό είδος έχει τη δυνατότητα σε χαμηλές θερμοκρασίες, χαμηλότερες των 10 βαθμών Κελσίου να μειώνει στο ελάχιστο τον μεταβολισμό του.

Σημείωση: Η μελέτη της καλλιέργειας ξεκινάει από την χρονική στιγμή t  στο μέσο της εκθετικής φάσης για θερμοκρασία 37,5 βαθμών Κελσίου που είναι ιδανική για αυτό το μικροβιακό είδος.

t0 – θερμοκρασία 37,5 βαθμοί Κελσίου.

t1- θερμοκρασία 5 βαθμοί Κελσίου

t2- θερμοκρασία 28 βαθμοί Κελσίου

t3-10mg/mL Νεομυκίνη

t4-25mg/mL Νεομυκίνη

t5-0,1mg/mL Χλωραφαινικόλη

t6-0,5mg/mL Χλωραφαινικόλη

t7- θερμοκρασία 80 βαθμοί Κελσίου

  1. Εξηγήστε τις διάφορές στην κλίση της καμπύλης της εκθετικής φάσης για τα χρονικά διαστήματα t0 -> t1, t1->t2, t2->t3 και t7->t8
  2. Ποια είναι η ανθεκτικότητα του βακτηριακού είδους έναντι του αντιβιοτικού της νεομυκίνης;
  3. Για ποιο λόγο σε μοριακό επίπεδο κάποια από τα κύτταρα της βακτηριακής καλλιέργειας δεν επιζούν παρουσία 10mg/mL, αλλά κάποια άλλα κύτταρα επιζούν παρουσία 25mg/mL;
  4. Εξηγήστε την συμπεριφορά του βακτηριακού είδους έναντι του αντιβιοτικού της χλωραφαινικολής στις διαφορετικές δόσεις.
  5. Για ποιο λόγο το βακτηριακό είδος εμφανίζει διαφορετική συμπεριφορά έναντι των δυο αντιβιοτικών. (μόρια 20)

2.Δίνονται οι παρακάτω καμπύλες που παρουσιάζουν την συνάρτηση μεταβολής του πληθυσμού για το βακτήριο E. coli σε θερμοκρασία α. 36,6 και β. 39 βαθμοί Κελσίου, ενώ όλοι οι υπόλοιποι παράγοντες διατηρούνται σταθεροί και ιδανικοί για την ανάπτυξη του μικροβίου σε συνεχή καλλιέργεια. Εξηγήστε γιατί ο χρόνος διπλασιασμού της καλλιέργειας είναι αντιστρόφως ανάλογος του ρυθμού ανάπτυξης του. (μόρια 5)

Διαγώνισμα Κεφ 7 blog-05

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;
  2. Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.

 

 

 

Βιολογία Ομάδας Θετικού Προσανατολισμού Πανελλήνιες Εξετάσεις 2016

Για καλούς λύτες;

 

Η Βιολογία Ομάδας θετικού Προσανατολισμού, όπως ακριβώς όφειλε ως το μάθημα με τον υψηλότερο συντελεστή (1,3), που καθορίζει το 1/3 (33%) της συνολικής βαθμολογίας του υποψηφίου για τα τμήματα της τριτοβάθμιας εκπαίδευσης των επιστήμων ζωής, μεταξύ των οποίων συγκαταλέγονται και οι περιζήτητες Ιατρικές σχόλες, φαίνεται ότι αποτέλεσε φέτος το φίλτρο επιλογής για τους φετινούς υποψηφίους, που από τον Σεπτέμβριο θα καθίσουν στα έδρανα των αμφιθεάτρων των ιατρικών σχολών.

Ωστόσο, και φέτος τα θέματα δεν στερούνταν δυστυχώς αστοχιών και προχειρότητας.

Πράγματι, αν προσέξουμε τα θέματα, έχουμε:

Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9, την διαδικασία κλωνοποίησης, και τον ορισμό και την δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει την θέση των μιτοχονδρίων στα κύτταρα και ποια κύτταρα διαθέτουν μιτοχόνδρια, γνώσεις που απέκτησε από την Β’ λυκείου.!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει:” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α ή η δ; Μήπως είναι και τα δυο;

Ένας μαθητής οφείλει να γνωρίζει από την Β’ λυκείου που βρίσκονται τα μιτοχόνδρια ώστε μπορεί να αποκλείσει το β, άλλα δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της β’ λυκείου για την Ντόλυ;;;

Θέμα Β. Ερώτημα Β1:

DNA δεσμάση:

Α. δημιουργία φωσφοδιεστερικών δεσμών;

Β. διασπάση φωσφοδιεστερικών δεσμών;

Γ. ούτε Α ούτε Β

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου στο συγκεκριμένο ένζυμο, στο δεύτερο και στο τέταρτο κεφάλαιο (δεν αναφέρεται πουθενά αλλού στο σχολικό της τρίτης λυκείου, ούτε και σε άλλο σχολικό βιβλίο μικρότερων τάξεων).

Όμως, από αυτές τις αναφορές ο μαθητής δεν μπορεί να συμπεράνει ποια είναι η δράση της δεσμάσης και τι είδους δεσμούς δημιουργεί!!!

Επομένως ποια είναι η σωστή αντιστοίχηση, με το Α που είναι πράγματι το επιστημονικώς ορθο, το οποίο όμως, πως θα το εξάγει ο μαθητής από το σχολικό βιβλίο; Ή μήπως σωστή, πρέπει να θεωρηθεί και η Γ, αφού δεν μπορεί να γνωρίζει αν συγκεκριμένα δημιουργεί φωσφοδιεστερικούς δεσμούς?

Είναι ιδιαιτέρως αξιοπρόσεκτο δε, το γεγονός ότι,στα θέματα του 2015 στο τρίτο θέμα που αφορούσε τα ένζυμα της αντιγραφής που δρούν στο σημείο σύνδεσης του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδια, με το τμήμα DNA του θυγατρικού κλώνου, το οποίο δημιούργησε η DNA πολυμεράση ως προϊόν επιμήκυνσης νωρίτερα αυτού του πρωταρχικού τμήματος, η περυσινή ΚΕΕ δεν ζητούσε και την δεσμάση!

Φέτος όμως ,η ΚΕΕ απαιτεί να γνωρίζει ο μαθητής τι είδους δεσμούς δημιουργεί η δεσμάση!!!! Πόσο άραγε θα έχουν μπερδευτεί τα παιδιά που ξαναδίνουν φέτος;;;;

Δηλαδή, πέρυσι η ΚΕΕ εκτίμησε ότι ο μαθητής δεν μπορεί να συνάγει τον ρόλο της δεσμάσης από το σχολικό βιβλίο, αλλά φέτος με το ίδιο ακριβώς σχολικό βιβλίο πιστεύει ότι ο μαθητής μπορεί να το συνάγει!!

Ερώτημα Β2: Τι είναι ο καρύοτυπος; Να αναφέρετε δυο (2) συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου ενός ανθρώπου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το πρώτο κεφάλαιο την διαδικασία δημιουργίας του καρυοτύπου (για να ξέρει ότι τα χρωμοσώματα είναι μεταφασικά και την διαζώνωση με την χρώση Giemsa), τον ορισμό του καρυοτύπου, την αναφορά του σχολικού βιβλίου στα αυτοσωμικά και φυλετικά χρωμοσώματα του ανθρώπου.

Από το έκτο κεφάλαιο, τις δυνατότητες διάγνωσης των αριθμητικών και των δομικών χρωμοσωμικών ανωμαλιών, τόσο στα τμήματα του βιβλίου που αναφέρονται οι μεταλλάξεις αυτές όσο και στο ειδικότερο τμήμα του σχολικού βιβλίου στο έκτο κεφάλαιο που αναφέρετε στις διαγνωστικές τεχνικές και στον προγενετικό έλεγχο. Επίσης θα έπρεπε (ή μήπως και να μην έπρεπε ; ) να έχει μελετήσει τον πινάκα 6.1 του σχολικού βιβλίου.

Από τα παραπάνω και δεδομένης της ασάφειας της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να αναφέρει διάφορους συδυασμούς από δυο συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου του ανθρώπου. Ας ελπίσουμε ότι η σωστή απάντηση δεν είναι ο μαναδικός συνδυασμός που σκέφτηκε η ΚΕΕ.

Αξίζει και εδώ να παρατηρήσουμε , όπως και στην περίπτωση της δεσμάσης, την έλλειψη πρωτοτυπίας του θέματος που αφορά τον καρυύτυπο, με το περυσινό τέταρτο ζήτημα στις πανελλήνιες του 2015 που αφορούσε και πάλι τον καρυότυπο. Αλλά και εδώ, όπως και στην δεσμάση, τα φετινά ζητούμενα αναιρούν τα περυσινά ζητούμενα σε σχέση με τον καρυότυπο όπως και στην περίπτωση της δεσμάσης.

Πιο συγκεκριμένα:

Πέρυσι η ΚΕΕ θεωρούσε δεδομένο από την εκφώνηση στο Δ1 ότι είναι δομική μετάλλαξη η ανάστροφη λιγότερων από δέκα νουκλεοτιδίων (ερχόμενη σε πλήρη αντίθεση τον ορισμό του βιβλίου)!!! Και ζητούσε από τα παιδιά να γράψουν ως σωστή απάντηση (και την δεχόταν ως σωστή!) ότι είναι δυνατή η παρατήρηση αυτής της μετάλλαξης στον καρυότυπο, όταν το σχολικό βιβλίο αναφέρει ότι τα νουκλεοσώματα που αποτελούνται από 146 ζεύγη βάσεων παρατηρούνται μόνο στο ηλεκτρονικό μικροσκόπιο και ότι ο καρυότυπος παρατηρείται στο οπτικό μικροσκόπιο!!!!

Η εκφώνηση δε, τουΔ4 το 2015 έλεγε:”Να εξηγήσετε το είδος ή τα είδη των δομικών χρωμοσωμικών ανωμαλιών, που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο”.

Εν ολίγης, ο μαθητής πέρυσι την ώρα των εξετάσεων  “έμαθε” ότι οι ανάστροφες τμημάτων DNA μεγέθους μικρότερου των 10 ζευγών βάσεων οδηγούν σε μη φυσιολογικό καρυότυπο και άρα παρατηρούνται στον καρυότυπο!!!

Εάν φέτος ο ίδιος μαθητής ξαναδίνει πανελλήνιες εξετάσεις και γράψει αυτό που “ έμαθε” πέρυσι θα θεωρηθεί σωστό από την ΚΕΕ και αν όχι, γιατί;

Σημείωση: Το πρόβλημα του μεγέθους των γονιδίων και των μεγάλων αλληλουχιών, μπορεί πολύ εύκολα να αντιμετωπιστεί με την ενδιάμεση  ύπαρξη, … , όπως χρησιμοποιήθηκε φέτος για την 5′ αμετάφραστη περιοχή, όχι όμως για το γονίδιο, το οποίο φυσικά δεν μπορεί να είναι τόσο μικρό  όσο δόθηκε. Ευτυχώς πάντως που χρησιμοποιήθηκε τουλάχιστον για την 5′ αμετάφραστη, ώστε να μην υπάρξουν τα προβλήματα που εμφάνιζε το Δ θέμα το 2014 με την 5′ αμετάφραστη περιοχή των 4 νουκλεοτιδίων στο mRNA, στο οποίο μάλιστα μπορούσε να συνδεθεί το ριβόσωμα κατά την ΚΕΕ!

Θέμα Γ. Ερώτημα Γ1: Να γράψετε στο τετράδιο  σας τον γονότυπο του ατόμου Ι 1 που βρίσκεται  στο γενεαλογικό δένδρο 1 και να αιτιολογήσετε την απάντησή σας.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Στο πέμπτο κεφάλαιο, την αναφορά του σχολικού βιβλίου για τις  ομάδες αίματος, τον πρώτο νόμο του Μέντελ, και την αναφορά του βιβλίου για τα γενεαλογικά δένδρα.

Σύμφωνα με αυτές τις γνώσεις αυτές και με βάση τα δεδομένα του γενεαλογικού δένδρου που δόθηκε, δεν υπάρχει μόνο ένας γονότυπος για το άτομο Ι1 αλλά δύο! Ποια είναι λοιπόν η σωστή απάντηση;

Η εύκολη λύση είναι όλα σωστά, αδικώντας τους μαθητές που βρήκαν και τις δυο λύσεις! Όμως σε διαφορετική περίπτωση αδικούν τους μαθητές που βρήκαν και τους δυο τρόπους άλλα έγραψαν μόνο τον ένα, αφού έναν τους ζητάει η εκφώνηση.

Η πιο σωστή λύση είναι να είναι απλώς ορθά διατυπωμένη η ερώτηση για να μην προκύπτουν τέτοια ζητήματα.

Ερώτημα Γ5: “ Βρέθηκε ότι στελέχη … αυτές οι μεταλλάξεις”.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου της Γ’ λυκείου στο δεύτερο κεφάλαιο, για την δομή και την λειτουργιά του οπερονίου.

Ακόμη από το δεύτερο κεφάλαιο την διαδικασία της μεταγραφής.

Επίσης από το έκτο κεφάλαιο τον ορισμό των μεταλλάξεων, τα είδη των μεταλλάξεων και ειδικότερα τις επιπτώσεις των γονιδιακών μεταλλάξεων στα γονίδια και στα προϊόντα τους.

Σύμφωνα με αυτές τις γνώσεις τις οποίες υποτίθεται ότι είναι οι μόνες που μπορεί να έχει και στις οποίες εξετάζεται, ο μαθητής ,εξάγει ότι οι μεταλλάξεις είναι τυχαία γεγονότα, που συμβαίνουν χωρίς σκοπιμότητα και οδηγούν σε απρόβλεπτα αποτελέσματα τόσο για το DNA, όσο και κατ΄ επέκταση για το γονιδιακό προϊόν των μεταλλαγμένων γονιδίων, άρα και για το κύτταρο. Επιπρόσθετα, συνάγει  ότι καθορισμένες αλληλουχίες DNA (π.χ υποκινητές) εμφανίζουν συγγένεια με κατάλληλες πρωτεΐνες (π.χ. μεταγραφικοί παράγοντες, καταστολέας οπερονίου). Αντιλαμβάνεται λοιπόν ο μαθητής, ότι αλλαγές είτε στην αλληλουχία του DNA,  είτε στην στερεοδιάταξη της κατάλληλης πρωτεΐνης δεν επιτρέπουν την σύνδεση της πρωτεΐνης με το DNA.

Επομένως, ανεξάρτητα από τον πραγματικό ορθό τρόπο λειτουργίας του οπερονίου της λακτόζης στο E.coli, ο οποίος δεν περιγράφεται  εξάλλου με λεπτομέρειες στο σχολικό, ο μαθητής μπορεί να υποθέσει διάφορες πιθανές περιπτώσεις που μπορούν να έχουν συμβεί και δεν εκφράζεται το οπερόνιο της λακτόζης στα δεδομένα στελέχη του βακτηρίου.

Ποιές θα θεωρηθούν σωστές και με ποια κριτήρια;

Οι “σωστές” απαντήσεις είναι άραγε μόνο όσες σκέφτηκαν οι θεματοδότες και ο λύτης; Αν είναι έτσι, πρέπει κάνεις να αναρωτηθεί αν στο μάθημα της Βιολογίας (δυστυχώς, όχι μόνο φέτος) τα παιδιά εξετάζονται πράγματι στη Βιολογία που διδάσκονται στο σχολείο (μόνο στην Γ ‘ Λυκείου;) ή μήπως στην μαντική τέχνη;

Σημείωση: Για την δομή του οπερονίου αξίζει κάνεις να προσέξει το κείμενο του βιβλίου, άλλα και την περίληψη του βιβλίου στο σημείο αυτό.

Θέμα Δ. Ερώτημα Δ3: Να γράψετε την αλληλουχία των βάσεων του mRNA, θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας, του γονιδίου της εικόνας 2.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το δεύτερο καφάλαιο την διαδικασία της μεταγραφής, της ωρίμανσης και της μετάφρασης των γονιδίων των ευκαρυώτικων οργανισμών.

Σύμφωνα λοιπόν με τα παραπάνω και με δεδομένη την εκφώνηση της ερώτησης, που ζητάει το τμήμα του μορίου του ωρίμου mRNA που θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας του γονιδίου που δόθηκε, η απάντηση που πρέπει να δώσει ο μαθητής είναι: Το ώριμο mRNA μέχρι και το κωδικόνιο λήξης ,εκτός της  υπόλοιπης 3′ αμετάφραστης περιοχής καθώς το σχολικό βιβλίο αλλα ούτε και κάποιο άλλο σχολικό βιβλίο βιολογίας προηγούμενων τάξεων, αναφέρει τον ρόλο της 3′ αμετάφραστης περιοχής του mRNA. Επομενως ο μαθητής προκείμενου να αποφύγει το λάθος να γράψει κάτι που δεν ξέρει αν χρησιμοποιείται στην μετάφραση, μπορεί να επιλέξει να μην το γράψει μόνο και μόνο για να είναι σύμφωνος με ότι τον ερωτάνε.

Ποια είναι λοιπόν η σωστή απάντηση; Αυτή που προκύπτει σύμφωνα με όσα αναλύθηκαν παραπάνω ή απλώς η σωστή απάντηση είναι για μια ακόμη άφορα αυτή και μόνο αυτή που σκέφτηκε ο λύτης των θεμάτων, πριν αυτά δοθούν στους μαθητές;

Ερώτημα Δ5: Στην εικόνα 4…ii) θέση 2.

Για να απαντησει ο μαθητης πρεπει να γνωριζει:

Από το πρώτο κεφάλαιο τον προσανατολισμό των πολυνουκλεοτιδικών αλυσίδων καθώς και την αντιπαραλληλία των δύο κλώνων ενός δίκλωνου μορίου νουκλεϊκών οξέων.

Από το δεύτερο κεφάλαιο τις διαδικασίες της μεταγραφής, της μετάφρασης  καθώς και τις ιδιότητες του γενετικού κώδικα.

Από το έκτο κεφάλαιο τον ορισμό της μετάλλαξης, την διάκριση των μεταλλάξεων αναλόγως του μεγέθους της αλλαγής, ειδικότερα τις γονιδιακές μεταλλάξεις και τις πιθανές αλλαγές που προκαλούν,  τόσο στο μόριο του  DNA όσο και κατά συνεπεία στα προϊόντα της μεταγραφής και πιθανόν της μετάφρασης.

Σύμφωνα λοιπόν με το παραπάνω περιεχόμενο του σχολικού βιβλίου και με βάση τα δεδομένα της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να υποθέσει δυο πιθανούς τρόπους ένθεσης της τριπλέτας (με ποιο μηχανισμό έγινε δυνατή η ένθεση; αυτό δεν αναφέρεται σε κανένα σημείο του σχολικού βιβλίου βιολογίας) που δίνεται, δηλαδή είτε όπως δίνεται είτε ανεστραμμένη  (κατά 180 μοίρες).

Ως προς το αποτέλεσμα της μεταλλαγής, πρέπει να αναφερθεί ο μαθητής τόσο στην αλλαγή στο DNA, όσο και στα παραγόμενα προϊόντα κάθε φορά (μετάλλαξη), εφόσον δεν προσδιορίζεται από την εκφώνηση η έννοια του αποτελέσματος , αν αφορά μόνο το γενετικό υλικό ή και το προϊόν του μεταλλαγμένου γονιδίου. Φυσικά, αναλόγως του τρόπου ένθεσης της τριπλέτας θα έχουμε διαφορετικά αποτελέσματα.

Συνεπώς, η διατύπωση του ερωτήματος άφηνε πολλές εκδοχές, όπου ένας καλά προετοιμασμένος μαθητής που θα τις σκεφτόταν, και θα ήθελε να τις γράψει δεν είναι βέβαιο ότι θα πραλάβαινε στον δεδομένο χρόνο. Αν αυτός  μαθητής ιεραρχούσε την σειρά των απαντήσεων του σε αυτό το ερώτημα, με τέτοιο τρόπο, που δεν προλαβαινε να γράψει την απάντηση που δόθηκε από τον θεματοδότη και τον λύτη?

Καταλήγοντας λοιπόν σε αυτόν τον σχολιασμό των θεμάτων της Βιολογίας Ομάδας Θετικού Προσανατολισμού 2016, μπορούμε να πούμε ότι τα φετινά θέματα θα επιτρέψουν πιθανόν, αλλά και δικαίως, στο μάθημα της Βιολογίας, όπως αρμόζει άλλωστε, να καθορίζει την διάκριση των υποψηφίων στην εισαγωγή τους στις σχόλες του πεδίου των Επιστήμων Ζωής, αφού αυτό είναι έτσι και αλλιώς το αντικείμενο μελέτης αυτών των σχολών όπως η Ιατρική, το Βιολογικό κ.ά.

[ Αποτελεί Παγκόσμια πρωτοτυπία να εισάγονται μαθητές στα βιολογικά τμήματα χωρίς να έχουν διδαχθεί Βιολογία και να μην εισάγονται μαθητές στα χημικά τμήματα ενώ έχουν διδαχθεί την ίδια ακριβώς ύλη χημείας με αυτούς που έχουν την δυνατότητα να εισαχθούν!]

Όμως η προχειρότητα και οι αστοχίες στην διατύπωση των θεμάτων, περιορίζουν την αντικειμενική βαθμολόγηση, μειώνοντας σημαντικά την διακριτική ικανότητα των θεμάτων να ξεχωρίσουν τους άριστους από τους κάλους και τους κάλους από τους μέτριους με τρόπο αντικειμενικό, ειδικότερα όταν οι ενδεικτικές απαντήσεις της ΚΕΕ είναι οι μόνες σωστές και η φράση “ κάθε απάντηση επιστημονικά τεκμηριωμένη θεωρείται σωστή” έχει περιορισμένη χρήση και άξια.

Τα θέματα, ενώ πρέπει να βγαίνουν μέσα από την εξεταστέα ύλη του [ή μήπως των σχολικών βιβλίων  και των προηγούμενων τάξεων, όπως στην Φυσικη και την έκθεση φέτος, αλλά και στην Χημεία γενικότερα (δεν ορίζεται στην γ’ λυκείου η έννοια του mol, αλλά στην α’ λυκείου) ; ] σχολικού βιβλίου και να είναι ορθώς διατυπωμένα με σαφήνεια και ακρίβεια δηλαδή να είναι ορθά επιστημονικώς όσο και φιλολογικά, θα πρέπει να απαιτούν κριτική σκέψη με αναλυτική και συνθετική ικανότητα από τους μαθητές, ακόμη πρέπει να έχουν διαβαθμισμένη δυσκολία, αλλά και οι απαντήσεις των μαθητών να κρίνονται μέσα στα πλαίσια που επιτρέπει το σχολικό βιβλίο σε συνδυασμό με την  γνώση που έχει αποκτήσει ο μαθητής από τις προηγούμενες τάξεις, άλλα και φυσικά κάθε επιστημονικά τεκμηριωμένη απάντηση που ξεφεύγει από το σχολικό βιβλίο να λαμβάνεται ως ορθή, εφόσον είναι πράγματι ορθή.

‘Ομως και οι διορθωτές για να κρίνουν την ορθότητα μια απάντησης ενός μαθητή που ξεφεύγει από τις ενδεικτικές απαντήσεις της ΚΕΕ και την αυτούσια αναπαραγωγή των λεγομένων του σχολικού βιβλίου,  πρέπει να γνωρίζουν Βιολογία (όχι αυστηρά μόνο του λυκείου) καλύτερα από τον διαγωνιζόμενο!

‘Ενας διάγωνιζόμενος, είναι αρκετά πιθανό να είναι πρωτοετής φοιτητής του Βιολογικου τμήματος ή της Φαρμακευτικης ή της Γεωπονικης ή της Κτηνιατρικης κ.ά.  και ενώ  παρακολούθησε τη σχολή και έδωσε μαθήματα στην εξεταστική του χειμερινού α’ εξαμήνου ίσως και ορισμένα του εαρινού εξαμήνου (άρα διδάχθηκε και διάβασε Βιολογία από πανεπιστημιακούς δασκάλους και πανεπιστημιακά συγγράματα), αποφάσισε να ξαναδώσει  πανελλήνιες, πιθανόν για να περάσει στην  Ιατρική ή σε άλλη πόλη. Αυτός ο διαγωνιζόμενος λοιπόν, κινδυνεύει να μην επιτύχει το στόχο του ούτε την δεύτερη φορά, επειδή παρακολούθησε Βιολογία στο πανεπιστήμιο;

Και τα μέλη της ΚΕΕ, πρέπει να αναλαμβάνουν την ευθύνη των θεμάτων και των λύσεων τους με γνωστοποίηση των ονομάτων τους μετά το πέρας των εξετάσεων.

Οι πανελλήνιες είναι εν πολλοίς, αδιάβλητες είναι όμως και αδιαφανείς.

Εν όψη των αλλαγών που αυτόν τον καιρό, προτείνονται για την εισαγωγή στην τριτιβαθμια εκπαίδευση, τίποτα από τα παραπάνω δεν ακυρώνεται. Θα πρέπει να διαμορφωθεί ένα σύστημα αξιοκρατικό, δίκαιο, διαφάνες αυτή τη φορά, το οποίο θα συνεχίζει να είναι αδιάβλητο και θα μπορεί να Ελεγχεται σε κάθε του στάδιο.

Βιολογία θετικής κατεύθυνσης και γενικής παιδείας – Τι πρέπει να προσέξω για να πετύχω!

nikimargariti

α. Λίγο πριν από τις εξετάσεις:

1ο  θέμα

Το πρώτο θέμα συνίσταται από ερωτήσεις κλειστού τύπου, συνήθως πολλαπλής επιλογής ή σπανιότερα σωστού λάθους και ορισμένες φορές απαιτείται αιτιολόγηση της επιλογής σας.

Σε αυτό το θέμα απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία της εξεταστέας ύλης του σχολικού βιβλίου. Είναι σημαντικό, όταν μαθαίνουμε την θεωρία του σχολικού βιβλίου να μην παραλείπουμε κανένα τμήμα της, ούτε τις λεπτομέρειές που αναφέρονται ακόμα και στις παρενθέσεις του κείμενου.

2ο θέμα

Το δεύτερο θέμα συνίσταται από ερωτήσεις ανάπτυξής, που αφορούν συνήθως αυτούσια αποσπάσματά του σχολικού βιβλίου.

Συνεπώς και σε αυτό το θέμα, απαντάμε σωστά όταν γνωρίζουμε άριστα την θεωρία του σχολικού βιβλίου.

3ο θέμα

Το τρίτο θέμα συνίσταται συνήθως από συνδυαστικές ερωτήσεις που αφορούν μια ή περισσότερες βιολογικές έννοιές ή φαινόμενα.

Για να απαντήσουμε σε αυτό το θέμα, απαιτείται και πάλι άριστη γνώση της ύλης του σχολικού βιβλίου καθώς και να έχουμε κατανοήσει επαρκώς τις…

Δείτε την αρχική δημοσίευση 453 επιπλέον λέξεις