Ένα σχόλιο για τη δυσκολία των θεμάτων των πανελληνίων εξετάσεων

Τα τελευταία χρόνια το Υπουργείο Παιδείας δημοσιεύει αναλυτικότερα στοιχεία για τις βαθμολογίες των υποψηφίων, τα οποία μας δίνουν τη δυνατότητα να αξιολογήσουμε τα θέματα των εξετάσεων και την καταλληλόλητά τους στον διαχωρισμό των υποψηφίων σε καλούς, πολύ καλούς και άριστους. Παραθέτουμε παρακάτω μια διαγραμματική απεικόνιση των κατανομών των βαθμολογιών των μαθητών για 5 βασικά μαθήματα, απαραίτητα για την εισαγωγή σε σχολές υψηλής ζήτησης για τα έτη 2016 και 2017.

Βαθμολογίες ανά μάθημα

Η Χημεία και η Φυσική είναι δύο μαθήματα στα οποία οι θεματοδότες αποτυγχάνουν θεαματικά να διαχωρίσουν τους άριστους από τους απλώς καλούς υποψηφίους. Και στα δύο μαθήματα παρουσιάζεται μια αριστερή ασσυμετρία στην κατανομή των βαθμολογιών, πράγμα που πρακτικά σημαίνει ότι μεγάλος αριθμός υποψηφίων γράφουν άριστα ή κάτι πολύ κοντά σε αυτό. Στη Χημεία συγκεκριμένα βλέπουμε ότι ιδιαίτερα το 2016, περίπου το 23% των υποψηφίων έγραψε 19-20. Το ίδιο πρόβλημα παρουσιάζεται, σε μικρότερο και με τα θέματα του 2017, καθώς και με τη Φυσική. Παρόμοιο πρόβλημα παρουσιάζεται και στη Βιολογία, αν και σε μικρότερη κλίμακα. Εδώ αξίζει να σταθούμε λίγο παραπάνω στη Φυσική, ένα παραδοσιακά δύσκολο μάθημα, στο οποίο όμως τα τελευταία δύο χρόνια «έπεσαν» εύκολα θέματα με αποτέλεσμα τη συσσώρευση αριστούχων στην κορυφή ακόμα και εκεί.

Η έκθεση από την άλλη πλευρά είναι ένα ιδιόμορφο μάθημα, στο οποίο από ότι φαίνεται είναι σχετικά εφικτό για έναν μαθητή να γράψει ανάμεσα στο 13-17, ενώ μόνο ένα πολύ μικρό ποσοστό των μαθητών καταφέρνει να αριστεύσει.

Η ιδανική κατανομή βαθμολογιών παρουσιάζεται στα μαθηματικά, όπου παρουσιάζεται μια δεξιά ασσυμετρία. Οι άριστοι μαθητές είναι λίγοι, αλλά όχι μηδαμινοί, όπως στην έκθεση και όσο χαμηλώνει ο βαθμός, τόσο αυξάνονται οι μαθητές που τον επιτυγχάνουν. Αυτό μπορεί να λογιστεί ως επιτυχία των θεματοδοτών στα μαθηματικά, οι οποίοι έχουν ελαχιστοποιήσει τα θέματα θεωρίας, άρα και την αποστήθιση, και κλιμακώνουν ορθά τη δυσκολία των θεμάτων τους, έτσι ώστε να επιτυγχάνεται η διάκριση των καλών, των πολύ καλών και των αρίστων υποψηφίων.

Οι θεματοδότες των υπόλοιπων μαθημάτων μπορούν να διδαχθούν πολλά από τους συναδέλφους τους των μαθηματικών. Πρωτότυπες ασκήσεις υπάρχουν πλέον και σε μαθήματα όπως η βιολογία, τα οποία παλαιότερα οι μαθητές αποστήθιζαν. Δε δικαιούμαστε να αδικούμε τους άριστους συνωστίζοντάς τους μαζί με ένα σημαντικό ποσοστό καλών απλώς υποψηφίων, οι οποίοι αριστεύουν λόγω των εύκολων θεμάτων στα περισσότερα μαθήματα.

 

Γιώργος Καρακατσάνης

Οικονομολόγος

Advertisements

Λύσεις Βιολογίας θετικού προσανατολισμού Πανελληνίων εξετάσεων 2017 – Ημερήσια

Βιολογία Ομάδας Θετικού Προσανατολισμού

ΘΕΜΑΤΑ 2017 ΗΜΕΡΗΣΙΑ ΓΕΛ

ΘΕΜΑ Α

Οι ζητούμενες απαντήσεις, είναι :

A1: δ , Α2 : δ , Α3 : β , Α4 : γ , Α5 : α

ΘΕΜΑ Β

B1

Ι → Α

Ι Ι → Ε

ΙΙΙ → ΣΤ

ΙVB

VZ

VI →Γ

VII → Δ

Β2

Η δοθείσα εικόνα 1 αντιστοιχεί σε προκαρυωτικό κύτταρο.

Αιτιολόγηση : Γνωρίζουμε ότι στα προκαρυωτικά κύτταρα οι διαδικασίες της μεταγραφής ενός γονιδίου που κωδικοποιεί για μόριο mRNA και της μετάφρασης αυτού του μορίου mRNA, συμβαίνουν ταυτόχρονα. Δηλαδή, πριν ολοκληρωθεί η μεταγραφή, έχει ήδη ξεκινήσει η μετάφραση του νεοσυντιθέμενου μορίου mRNA καθώς είναι άμεσα δυνατή η πρόσδεση της μικρής ριβοσωμικής υπομονάδας στην 5′ αμετάφραστη περιοχή του mRNA. Αυτό είναι δυνατό καθώς τα βακτηριακά κύτταρα δεν διαθέτουν πυρηνική μεμβράνη και επομένως το μόριο DNA βρίσκεται στο κυτταρόπλασμα στην περιοχή του πυρηνοειδούς μαζί με τα ριβοσώματα, τα οποία είναι τα ειδικά σωματίδια του κυττάρου, που μαζί με άλλα μόρια (π.χ tRNA , rRNA κ.α ) και αρκετή ενέργεια πραγματοποιούν την διαδικασία της πρωτεϊνοσύνθεσης του κυττάρου.

Β3

Το ιδανικό φάρμακο είναι εκείνο που δεν επιφέρει καμία παρενέργεια στον οργανισμό ενώ ταυτόχρονα θεραπεύει αποτελεσματικά. Το ιδανικό φάρμακο είναι τα αντισώματα.

Τα αντισώματα είναι πρωτεϊνικά μόρια που παράγει ο οργανισμός των θηλαστικών (και των πτηνών) και έχουν την δυνατότητα να συνδέονται εκλεκτικά με ένα ορισμένο τμήμα ( αντιγονικός καθοριστής ) ενός ξένου προς τον οργανισμό σώματος (αντιγόνο).

Το αντιγόνο είναι ξένη προς τον οργανισμό ουσία που μπορεί να προκαλέσει ανοσολογική απόκριση, δηλαδή παραγωγή από τον οργανισμό ειδικών κυττάρων (λεμφοκυττάρων) και κυτταρικών προϊόντων ( π.χ αντισώματα) που θα δράσουν για την εξουδετέρωση του.

Τα αντισώματα παράγονται από τα Β-λεμφοκύτταρα του οργανισμού, κάθε διαφορετικό Β-λεμφοκύτταρο παράγει συγκεκριμένο διαφορετικό αντίσωμα, κατάλληλο για την αναγνώριση και την σύνδεση του μ’ έναν συγκεκριμένο αντιγονικό καθοριστή. Τα αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυττάρων είναι όλα όμοια μεταξύ τους και ονομάζονται μονοκλωνικά αντισώματα.

Τα μονοκλωνικά αντισώματα βρίσκουν πολλές εφαρμογές ως διαγνωστικά εργαλεία στην Βιολογία και την Ιατρική. Τα μονοκλωνικά αντισώματα δεν μπορούν να παραχθούν σε μεγάλες ποσότητες από τα Β-λεμφοκύτταρα όταν αυτά αναπτύσσονται σε κυτταροκαλλιέργειες in vitro καθώς τα φυσιολογικά Β – λεμφοκύτταρα (κυτταρική σειρά) δεν μπορούν να διαιρεθούν περισσότερες από 50 με 70 φορές, μιτωτικά, στην κυτταροκαλλιέργεια.

Προκειμένου λοιπόν να παραχθούν τα μονοκλωνικά αντισώματα που θέλουμε σε μεγάλες ποσότητες, πρέπει να συντηχθούν τα ειδικά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα (τα κύτταρα αυτά έχουν παραχθεί σε ένα ποντίκι εμβολιασμένο με τον επιθυμητό αντιγονικό καθοριστή, το οποιο πραγματοποιεί πρωτογενή ανοσοβιολογική απόκριση εναντίον αυτού του αντιγονικού καθοριστή) με καρκινικά Β-λεμφοκύτταρα ποντικού (μυέλωμα). Τα κύτταρα που προκύπτουν από την σύντηξη, ονομάζονται υβριδώματα και εμφανίζουν τις δύο ιδιότητες που θέλουμε, να παράγουν τα επιθυμητά αντισώματα και να διαιρούνται για πολύ περισσότερες φορές από 50-70 διαιρέσεις σε κυτταροκαλλιέργεια in vitro. Η τελευταία ιδιότητα είναι ιδιότητα των καρκινικών κυττάρων.

Έτσι προκειμένου να παράγουμε μονοκλωνικά αντισώματα που αναγνωρίζουν και συνδέονται με την χορειακή γοναδοτροπίνη του ανθρώπου ώστε να δημιουργήσουμε ένα ευαίσθητο διαγνωστικό έλεγχο για την εγκυμοσύνη στα πρώτα στάδια της, πρέπει :

α) Να χορηγήσουμε με ένεση σ’ ένα υγιές ποντίκι, ανθρώπινη χορειακή γοναδοτροπίνη, που έχουμε απομονώσει από γυναίκα που είναι έγκυος στα πρώτα στάδια της εγκυμοσύνης. Θεωρούμε δεδομένο ότι το ποντίκι δεν παράγει χορική γοναδοτροπίνη όμοια με του ανθρώπου, ώστε η ανθρώπινη ορμόνη να λειτουργήσει ως αντιγόνο σε αυτό. Επίσης, το ποντίκι που εμβολιάστηκε με την ανθρώπινη ορμόνη, ζει σε στείρο περιβάλλον ώστε να μην παράγει κατά το δυνατό αλλά αντισώματα, διαφορετικά από τα ζητούμενα, ώστε να διευκολυνθούμε στην απομόνωση των κατάλληλων Β-λεμφοκυττάρων

β) 15 μέρες μετά τον εμβολιασμό του, όταν έχει μεγιστοποιηθεί η ανοσολογική πρωτογενής αντίδραση του ποντικιού έναντι της ανθρώπινης ορμόνης, από το ποντίκι αφαιρείται ο σπλήνας του. Ο σπλήνας είναι δευτερογενές λεμφικό όργανο των θηλαστικών, στο οποίο πραγματοποιείται η ανοσολογική απόκριση .Επομένως, στον σπλήνα θα υπάρχουν πολλά Β-λεμφοκύτταρα του ποντικιού που παράγουν το επιθυμητό αντίσωμα.

γ) Από τον σπλήνα του ποντικιού απομακρύνονται τα επιθυμητά Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντίσωμα .

δ) Τα κατάλληλα Β-λεμφοκύτταρα του ποντικιού συντήκονται με καρκινικά Β-λεμφοκύτταρα ποντικιού που αναπτύσσονται σε κυτταροκαλλιέργεια (μυέλωμα). Τα προϊόντα της κυτταρικής σύντηξης ονομάζονται υβριδώματα. Τα Β-λεμφοκύτταρα που παράγουν το επιθυμητό αντισωμα δίνουν στο υβρίδωμα τη δυνατότητα να παράγει το επιθυμητό αντισωμα και τα καρκινικά κύτταρα προσδίδουν αθανασία.

ε) Από τα υβριδώματα που παράγονται κάποια ευαισθητοποιούνται με την ανθρώπινη χορειακή γοναδοτροπίνη, όποτε κλωνοποιούνται (μιτωτικά) και στην συνέχεια κατά ένα μέρος τους διαφοροποιούνται σε πλασματοκύτταρα, τα οποία παραγάγουν και εκκρίνουν μεγάλες ποσότητες του επιθυμητού αντισώματος ενώ τα υπόλοιπα φυλάγονται στην κατάψυξη (-800C) για μεταγενέστερη χρήση.

Τα παραγόμενα από τα κατάλληλα υβριδώματα, μονοκλωνικά αντισώματα, που αναγνωρίζουν την ανθρώπινη χορειακή γοναδοτροπίνη, μπορούν τώρα να χρησιμοποιηθούν ως διαγωνιστικά εργαλεία για τον έλεγχο της ύπαρξης κύησης, κυρίως σε γυναίκες που βρίσκονται στα πρώτα στάδια της εγκυμοσύνης.

Η λήψη αίματος από μια γυναίκα που επιθυμεί να μάθει αν είναι έγκυος και η χρήση των μονοκλωνικών αντισωμάτων για τον ποσοτικό και ποιοτικό προσδιορισμό της χορειακής γοναδοτροπίνης της, μας επιτρέπει να γνωρίζουμε αν είναι έγκυος (εφόσον διαθέτει την ορμόνη στο αίμα της, ποιοτικός έλεγχος) και σε ποια αρχική εβδομάδα της κύησης βρίσκεται (ανάλογα με την ποσότητα της ορμόνης που εντοπίστηκε) .

Β4

Η τεχνολογία του ανασυνδυασμένου DNA έχει δώσει τη δυνατότητα δημιουργίας γονιδιωματικών βιβλιοθηκών των οργανισμών.

Η γονιδιωματική βιβλιοθήκη ενός οργανισμού είναι το σύνολο των βακτηρικών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό (με άγαρ) και κάθε κλώνος φέρει ενσωματωμένο σε ένα μόριο φορέα κλωνοποίησης (πλασμίδιο ή DNA λ-φάγου αντιστοίχως) ένα ορισμένο τμήμα από το DNA του οργανισμού, του οποίου δημιουργούμε την βιβλιοθήκη.

Αυτό το τμήμα του DNA του οργανισμού δότη του γενετικού υλικού (δηλαδή του οργανισμού του οποίου δημιουργούμε την γονιδιωματική βιβλιοθήκη), υπάρχει σε πολλαπλά αντίγραφα σε κάθε κλώνο της βιβλιοθήκης, δηλαδη, το DNA του οργανισμού δότη έχει κλωνοποιηθεί.

Το σύνολο των κλώνων της γονιδιωματικής βιβλιοθήκης φέρει το σύνολο του γονιδιώματος του οργανισμού δότη (συνήθως χωρίς το μιτοχόνδριακό ή/και το χλωροπλαστικό DNA -το τελευταίο μόνο σε περίπτωση φυτικού οργανισμού- αναφερόμενο σε ευκαρυωτικό οργανισμό) σε πολλά διαφορετικά τμήματα σε πολλά αντίγραφα το κάθε τμήμα. Γονιδιωματικές βιβλιοθήκες δημιουργούνται και για προκαρυωτικούς και για ευκαρυωτικούς οργανισμούς.

Γνωρίζουμε ότι τα κύτταρα ενός πολυκυτταρικού οργανισμού φέρουν όλα τα ίδιο γενετικό υλικό (εκείνο το DNA, του ζυγωτού του οργανισμού αυτού) αφού όλα είναι προϊόντα μίτωσης του πρώτου διπλοειδούς κυττάρου (ζυγωτό) αυτού του οργανισμού. ‘Έτσι όλα τα απόγονα κύτταρα από την μίτωση κυττάρων που διαιρούνται, ενός ζωικού οργανισμού, όπως είναι τα μυϊκά και τα ηπατικά, θα φέρουν το ίδιο DNA (θεωρούμε ότι δεν έχουν συμβεί καινοφανείς μεταλλάξεις στα όργανα αυτά).

Η δημιουργία της γονιδιωματικής βιβλιοθήκης ενός οργανισμού περιλαμβάνει τα εξής βήματα:

Α) Απομόνωση κυττάρων του οργανισμού π.χ μυϊκά ή/και ηπατικά.

Β) Απομόνωση του DNA των κυττάρων αυτών, με λύση των κυττάρων.

Γ) Πέψη του DNA των κυττάρων αυτών με μία ορισμένη περιοριστική ενδονουκλέαση π.χ EcoRI. H περιοριστική ενδονουκλέαση αναγνωρίζει και κόβει με συγκεκριμένη φορά, μία ορισμένη δίκλωνη αλληλουχία DNA μήκους 4-8 ζευγών βάσεων. Η EcoRI για παράδειγμα αναγνωρίζει την δίκλωνη αλληλουχία:

5’GAATΤC3’

3’CTTAAG5’

και κόβει μεταξύ του G και του Α με προσανατολισμό 5’→3’ αφήνοντας αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα). Κάθε περιοριστικό ένζυμο δημιουργεί τέτοια κολλώδη άκρα όπως αυτά προκύπτουν με βάση την αλληλουχία αναγνώρισης DNA που αναγνωρίζει αυτό το ένζυμο. Για την EcoRI:

 

5’G 3′           5′ AATΤC3’

3’CTTAA 5′           3′G5’

AATT : κολλώδες άκρο Ι

TTAA : κολλώδες άκρο ΙΙ

Τα κολλώδη άκρα Ι και ΙΙ είναι συμπληρωματικά. Κάθε περιοριστικό ένζυμο κόβει το δίκλωνο DNA σε δυο φωσφοδιεστερικούς δεσμούς 3’→5’ και το ανάλογο πλήθος δεσμών υδρογόνου, σύμφωνα με την αλληλουχία αναγνώρισης του. Η ΕcoRI σπάει 8 δεσμούς υδρογόνου μεταξύ των 4 ζευγών βάσεων Α και Τ.

Δ) Απομόνωση κατάλληλου φορέα κλωνοποίηση, πλασμίδιο ή DNA φαγού λ και πέψη του φορέα κλωνοποίησης με το ίδιο περιοριστικό ένζυμο που χρησιμοποιήθηκε στο προηγούμενο βήμα, ώστε να δημιουργηθούν συμπληρωματικά κολλώδη άκρα .

Ε) Ανάμιξη και ανασυνδυασμός των τμημάτων DNA του οργανισμού δότη και των κομμένων φορέων κλωνοποίησης με την προσθήκη DNA δεσμάσης για την ένθεση – δημιουργία δυο 3′->5′ φωσφοδιεστερικων δεσμών ανα σημειο συνδεσης- ενός τμήματος DNA του οργανισμού δότη σε έναν φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακους φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου της καλλιέργειας (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών, για την ανάπτυξη αποικιών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Εφόσον σύμφωνα με τα δεδομένα της εκφώνησης τα ένζυμα και οι τεχνικές που χρησιμοποιούνται είναι ίδια τόσο για τη δημιουργία της βιβλιοθήκης του ηπατικού όσο και του μυϊκού κυττάρου, οι δύο γονιδιωματικές βιβλιοθήκες θα είναι ίδιες, εφόσον δεν φέρουν τα κύτταρα που απομονώσαμε από αυτά τα όργανα μεταλλάξεις.

cDNA βιβλιοθήκη ενός κυτταρικού τύπου ενός ευκαρυωτικού οργανισμού είναι το σύνολο των βακτηριακών κλώνων ή των φαγικών πλακών που αναπτύσσονται σε στερεό θρεπτικό υλικό και φέρουν σε πολλαπλά αντίγραφα, το ολικό ώριμο mRNA του κυτταρικού τύπου με τη μορφή δίκλωνου DNA ενσωματωμένο σε φορείς κλωνοποίησης (πλασμίδια ή DNA λ-φάγου, αντιστοίχως).

Η διαδικασία δημιουργίας της cDNA βιβλιοθήκης ενός κυτταρικού τύπου εν συντομία, είναι:

Α) Απομόνωση κυττάρων του κυτταρικού τύπου του οργανισμού π.χ μυϊκά ή ηπατικά στο κατάλληλο αναπτυξιακό στάδιο στην επιθυμητή φάση του κυτταρικού κύκλου των κυττάρων, στις επιθυμητές συνθήκες για τον οργανισμό.

Β) Απομόνωση του ολικού ώριμου mRNA των κυττάρων αυτών με ήπια λύση των κυττάρων.

Γ) Χρήση του ολικού ωρίμου mRNA ως καλούπι για την σύνθεση cDNA με την βοήθεια της αντίστροφης μεταγραφάσης.

Δ) Δημιουργία δίκλωνου DNA από το cDNA με την βοήθεια της DNA πολυμεράσης.

Ε) Ένθεση του δίκλωνου DNA, μετά από κατάλληλη κατεργασία, σε φορέα κλωνοποίησης.

ΣΤ) Μετασχηματισμός ή μόλυνση βακτηρίων ξενιστών σε υγρή καλλιέργεια με τους πλασμιδιακούς φορείς κλωνοποίησης ή τους ανασυνδυασμένους μολυσματικούς φάγους αντιστοίχως.

Ε) Επίστρωση της υγρής καλλιέργειας σε στερεό θρεπτικό υλικό και τοποθέτηση του τρύβλιου (στέρεο θρεπτικό υλικό) σε κατάλληλο περιβάλλον ανάπτυξης των βακτηρίων ξενιστών.

Ζ) Διατήρηση της βιβλιοθήκης σε κατάλληλες συνθήκες.

Η cDNA βιβλιοθήκη ενός κυτταρικού τύπου διαφέρει ανάλογα με το αναπτυξιακό στάδιο του οργανισμού καθώς και την φάση των κυττάρων του οργανισμού δότη, που έγινε η απομόνωση του ολικού ώριμου mRNA των κυττάρων του, εξαιτίας του γεγονότος ότι, διαφορετικά γονίδια εκφράζονται σε κάθε χρονική στιγμή.

Επίσης, η cNAD βιβλιοθήκες δύο διαφορετικών κυτταρικών τύπων του ίδιου οργανισμού, την ίδια χρονική στιγμή, διαφέρουν εξαιτίας της κυτταρικής διαφοροποίησης, δηλαδή της επιλεκτικής έκφρασης διαφορετικών γονιδίων από κάθε κύτταρο που ανήκει σε διαφορετικό κυτταρικό τύπο του ίδιου οργανισμού, όπως το ήπαρ και οι μύες, ώστε κάθε κύτταρο του κάθε κυτταρικού τύπου, να διαθέτει τις κατάλληλες πρωτεΐνες για την σωστή δομή και λειτουργία του, στο ορισμένο αναπτυξιακό στάδιο του οργανισμού και τις συνθήκες που επικρατούν στον οργανισμό και στο περιβάλλον του, έτσι ώστε να ανταποκριθούν καταλλήλως τα κύτταρα του κάθε κυτταρικού τύπου.

Βεβαίως κάθε κύτταρο ενός οργανισμού παράγει και πρωτεΐνες που είναι αναγκαίες για τις βασικές λειτουργίες του όπως π.χ τις λειτουργίες της μεταγραφής και της μετάφρασης καθώς και της αντιγραφής για τα μυϊκα και τα ηπατικά κύτταρα, τα οποία διαιρούνται. Επομένως, οι cDNA βιβλιοθήκες ενός ηπατικού και ενός μυϊκού κυττάρου αναμένεται να έχουν πολλούς διαφορετικούς κλώνους και ορισμένους κοινούς κλώνους.

ΘΕΜΑ Γ

Γ1

Θεωρούμε ότι η α1 αντιθρυψίνη που αναφέρεται στην εκφώνηση του ερωτήματος είναι η πρωτεΐνη του ανθρώπου που παράγεται στο ήπαρ και η έλλειψη της οδηγεί σε πνευμονικό εμφύσημα.

Γνωρίζουμε ότι μπορούμε σήμερα να δημιουργήσουμε διαγονιδιακά ζώα, δηλαδή ζώα, που με την τεχνολογία του ανασυνδυασμένου DNA, φέρουν ένα ετερόλογο γονίδιο, δηλαδή γονίδιο ενός άλλου είδους όπως παραδείγματος χάριν του ανθρώπου, στο γονιδίωμά τους. Τα ζώα αυτά χρησιμοποιούνται σήμερα ως εργοστάσια παραγωγής ανθρώπινων πρωτεϊνών (gene farming) καθώς είναι δυνατή η έκφραση των ανθρώπινων γονιδίων από τα ζωικά κύτταρα.

Για να εκφράσει ένα γονίδιο πρέπει στα κύτταρα του κυτταρικού τύπου του ευκαρυωτικού οργανισμού οπου θα εκφράζεται αυτό το γονίδιο, να υπάρχουν οι κατάλληλοι μεταγραφικοί παράγοντες οι οποιοι αναγνωρίζουν και συνδέονται με τον υποκινητή του γονιδίου αυτού, δηλαδή του γονιδίου, που εκφράζεται. Μόνο όταν ο σωστός συνδυασμός μεταγραφικών παραγόντων έχει συνδεθεί στον υποκινητή του γονιδίου, είναι δυνατή η σύνδεση της RNA πολυμεράσης με τον υποκινητή του γονιδίου αυτού, ώστε να ξεκινήσει σωστά η μεταγραφή του.

Επίσης δεδομένου ότι ο γενετικός κώδικας είναι σχεδόν καθολικός, δηλαδή όλοι οι οργανισμοί έχουν τον ίδιο γενετικό κώδικα και σε συνδυασμό με το γεγονός πως τα ριβοσώματα των οργανισμών μπορούν να χρησιμοποιηθούν ως θέσεις πρωτεινοσυνθεσης για οποιοδήποτε μόριο mRNA οποιουδήποτε οργανισμού ή ιού. Το ζωικό κύτταρο θα μπορεί να μεταφράσει το mRNA που θα προκύψει από την μεταγραφή του ανθρώπινου γονιδίου, το οποίο είναι ενσωματωμένο κατάλληλα στο γονιδίωμα του ζώου.

Ένα διαγονιδιακό ζώο που θέλουμε να παράγει την ανθρώπινη α1-αντιθρυψίνη στα μαστικά του κύτταρα, θα πρέπει να έχει δημιουργηθεί με τέτοιο τρόπο ώστε το ανθρώπινο γονίδιο που με μικροέγχυση έχει εισέλθει στο γονιμοποιημένο ωράριο του ζώου, να έχει τοποθετηθεί στο γονιδίωμα του ζώου με τέτοιο τρόπο, ώστε να βρίσκεται υπό τον έλεγχο του υποκινητή ενός γονιδίου του ζώου, το οποίο εκφράζεται αποκλειστικά στα μαστικά κύτταρα. Τέτοιο γονίδιο του ζώου, είναι το γονίδιο της καζεΐνης, μιας πρωτεΐνης του γάλακτος του ζώου.

Σύμφωνα με τα δεδομένα της εκφώνησης, το ανθρώπινο γονίδιο της α1-αντιθρυψίνη έχει τοποθετηθεί με το σωστό προσανατολισμό μέσα στο γονίδιο της καζεΐνης του γάλακτος του ζώου, δηλαδή η κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης έχει τοποθετηθεί με το 5’ άκρο της προς τον υποκινητή του γονιδίου της ζωικής καζεΐνης και συνεπώς η μη-κωδική αλυσίδα του γονιδίου της α1-αντιθρυψίνης θα έχει το 3’άκρο της προς τον υποκινητή του γονιδίου της καζεΐνης του ζώου. Έτσι , κατά την μεταγραφή του γονιδίου της καζεΐνης του ζώου από την RNA πολυμεράση του ζώου, θα μεταγράφεται η μη κωδική αλυσίδα του γονιδίου της ανθρώπινης α1-αντιθρυψίνης. ‘Έτσι το ζωικό κύτταρο στη συνέχεια, μετά την μεταγραφή του γονιδίου της ανθρώπινης α1-αντιθρυψίνης, θα ωριμάσει αρχικά (αν το ανθρώπινο γονίδιο δεν έχει απομονωθεί από cDNA βιβλιοθήκη ανθρωπίνων ηπατικών κυττάρων) και θα μεταφράσει στη συνέχεια, το κατάλληλο mRNA για την παραγωγή της ανθρώπινης πρωτεΐνης σε πρόδρομη μορφή. Η λειτουργική πρωτεΐνη α1-αντιθρυψίνη του ανθρώπου, θα δημιουργηθεί από τους μετά-μεταφραστικούς μηχανισμούς του ζώου, που δεν διαφέρουν από εκεινους του ανθρώπου καθώς και τα δυο είδη είναι θηλαστικά.

Γ2

Μας δίνεται το δίκλωνο γραμμικό τμήμα DNA:

5’GAATTCCGCAAATTAA

3’CTTAAGGCGTTTAATT5’

To οποίο πέπτεται από το περιοριστικό ένζυμο ΕcoRI . Το περιοριστικό ένζυμο EcoRI αναγνωρίζει την δίκλωνη αλληλουχία

5’GAATTC3’

3’ CTTAAG5’

και κόβει με προσανατολισμό 5’→3’ μεταξύ του G και Α σπάζοντας τους φοσφωδιεστερικούς δεσμούς μεταξύ τους και ταυτόχρονα σπάει και τους 8 δεσμούς υδρογόνου μεταξύ των συμπληρωματικών ζευγών Α και Τ, αφήνοντας μονόκλωνες αζευγάρωτες βάσεις στα κομμένα άκρα (κολλώδη άκρα).

Δηλαδή μετά την επίδραση της EcoRI το δοθέν τμήμα DNA πέπτεται ως εξής, εφόσον φέρει μοναδική θέση αναγνώρισης του περιοριστικού ενζύμου στα αριστερά.

ΕΙΚΟΝΑ Α

5’G3΄            5΄AATTCCGCAAATTAA

3’CTTAA5΄           3′ GGCGTTTAATT5’

3′ TTAA5’ KOΛΛΩΔΕΣ ΑΚΡΟ Ι

AATΤ ΚΟΛΛΩΔΕΣ ΑΚΡΟ ΙΙ

Η τεχνολογία του ανασυνδυασμένου DNA είναι το σύνολο των τεχνικών και των μεθόδων που μας επιτρέπουν την επέμβαση μας στο γενετικό υλικό των οργανισμών.

Μέσω της τεχνολογίας αυτής είναι δυνατή η ένθεση ενός γραμμικού δίκλωνου τμήματος DNA, που έχει κοπεί σε δύο σημεία με την ίδια περιοριστική ενδονουκλέαση, ώστε να φέρει στα δύο άκρα του συμπληρωματικά κολλώδη άκρα. Το τμήμα αυτό μπορεί να ενθεθει σ΄ ένα πλασμίδιο, όταν το πλασμίδιο έχει κοπεί σε μοναδικό σημείο από την ίδια περιοριστική ενδονουκλέαση ώστε να φέρει συμπληρωματικά κολλώδη άκρα στο σημείο τομής.

2017 Blog 8-9-01

Όπως προκύπτει από τις εικόνες Α και Β είναι αδύνατη η έκθεση του τμήματος που μας δίνεται σε πλασμίδιο που έχει κοπεί μία φορά με το ΕcoRI, καθώς το τμήμα που μας δίνεται διαθέτει μόνο μία φορά την αλληλουχία που αναγνωρίζεται από την ΕcoRI και επομένως φέρει ένα μονάχα κολλώδες άκρο στην μία ακριανή πλευρά του (εικόνα Α).

Η ένθεση του τμήματος που μας δίνεται θα ήταν εφικτή με το δοθέν πλασμίδιο, μονάχα αν ήταν δυνατό να προστεθεί το κατάλληλο κολλώδες άκρο, με την βοήθεια κατάλληλου ενζύμου, στο δεξιό άκρο του τμήματος μας.

Γ3

Σύμφωνα με τα δεδομένα της εκφώνησης έχουμε το παρακάτω γενεαλογικό δέντρο:

2017 Blog 8-9-01 extra 1

Η μελέτη της κληρονομικότητας στον άνθρωπο εμφανίζει πολλές δυσκολίες καθώς ο άνθρωπος δεν εμφανίζει τα χαρακτηριστικά του κατάλληλου οργανισμού μοντέλου για την Γενετική. Ο άνθρωπος έχει μεγάλο χρόνο γενεάς, αφήνει λίγους απογόνους και δεν επιδέχεται επιλεκτικές διασταυρώσεις. Επομένως, η μελέτη της Γενετικής του ανθρώπου γίνεται με την δημιουργία γενεαλογικών δέντρων, δηλαδή μιας διαγραμματικής απεικόνισης των γάμων και των γεννήσεων μιας οικογένειας για πολλές γενεές .

Σύμφωνα με τα δεδομένα της άσκησης μια γυναίκα (Γ1) παντρεύτηκε με δύο διαφορετικούς συζύγους στην διάρκεια της ζωής της και απέκτησε με τον καθένα από ένα παιδί .

Η γυναίκα έχει ομάδα αίματος 0, και ο ένας σύζυγος της έχει ομάδα αίματος ΑΒ (Σ1) ενώ ο άλλος έχει ομάδα αίματος Α (Σ2). Το παιδί Π1 έχει ομάδα αίματος 0 και το παιδί Π2 έχει ομάδα αίματος Β.

Γνωρίζουμε ότι η ταυτοποίηση των ομάδων αίματος του ανθρώπου μπορεί να γίνει με τη χρήση κατάλληλων διαγνωστικών εργαλείων, όπως είναι τα μονοκλωνικά αντισώματα.

Ένα άτομο με ομάδα αίματος 0 δεν εμφανίζει κανένα αντιγόνο ούτε Α, ούτε Β στην επιφάνεια των ερυθροκυττάρων του, επομένως κατά την ταυτοποίηση με αντι-Α-αντισώματα και αντί-Β-αντισώματα, δεν θα πραγματοποιηθεί ανοσολογική αντίδραση in vitro, μεταξύ των ερυθροκυττάρων του ατόμου και των αντί-Α και αντί-Β αντισωμάτων.

Ένα άτομο με ομάδα αίματος ΑΒ θα εμφανίζει στην επιφάνεια των ερυθροκυττάρων του και το αντιγόνο Α και το αντιγόνο Β και in vitro, θα εμφανίζει ανοσολογική αντίδραση με τα δυο διαφορετικά είδη αντισωμάτων που αναγνωρίζουν αυτά τα αντιγόνα. Ομοίως σκεπτόμενοι, άτομα με ομάδα αίματος Α αντιδρά ανοσολογικά μόνο με το αντι-Α-αντίσωμα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με τα αντί-Α-αντίσωματα και άτομο ομάδας αίματος Β αντιδρά ανοσολογικά μόνο με το αντι-Β-αντίσωματα.

Γνωρίζουμε ότι το γονίδιο Ι που ελέγχει για τις ομάδες αίματος είναι αυτοσωμικό και έχει τρία πολλαπλά αλληλόμορφα τα ΙΑ, ΙΒ , και i . Τα ΙΑ και ΙΒ είναι συνεπικρατή μεταξύ τους και επικρατούν του i. Tο αλληλόμορφο ΙΑ κωδικοποιεί για μια πρωτεΐνη που μετατρέπει μια πρόδρομη ουσία σε αντιγόνο Α, το οποίο τοποθετείται στην επιφάνεια των ερυθροκυττάρων. Ομοίως το ΙΒ κωδικοποιεί την πρωτεΐνη που σχηματίζει το αντιγόνο Β, ενώ το αλληλόμορφο i δεν κωδικοποιεί για κάποια πρωτεΐνη. Έτσι άτομα με γονότυπο ΙΑ ΙΑ και ΙΑI έχουν φαινότυπο ομάδα αίματος Α. Τα άτομα με το γονότυπο ΙΒ ΙΒ ή ΙΒ i έχουν φαινότυπο ομάδα αίματος Β, άτομα γονότυπου ΙΑΙΒ έχουν φαινότυπο ομάδα αίματος ΑΒ και τέλος τα άτομα γονότυπου ii έχουν ομάδα αίματος 0.

Σύμφωνα με τα παραπάνω και με δεδομένο ότι κάθε γονέας κληροδοτέι ένα πλήρες απλοειδές γονιδίωμα σε κάθε απόγονο του σύμφωνα με τον 1ₒ νόμο του Μendel, ο οποίος αναφέρει ότι κατά τον σχηματισμό των γαμετών, τα αλληλόμορφα γονίδια διαχωρίζονται και κατανέμονται στους γαμέτες τυχαία μεν άλλα ισοπιθανα δε. Η γονιμοποίηση είναι τυχαίο γεγονός.

Έχουμε λοιπόν τις εξής δύο διασταυρώσεις :

  1. Ρ1 : Γ1 Χ Σ1

F1 : Παιδί Α

Δηλαδή : Ρ1 : ii × IA I B

γαμέτες : i, i / IA , IB

γαμέτες/ γαμέτες

IA

IB

i

IAi

IBi

i

IAi

IBi

Oι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών μιας διασταύρωσης και τρόπου συνδυασμού τους, μεταξύ τους.

Γονοτυπική αναλογία F1 γενεάς: IAi : IBi

Φαινοτυπική αναλογία F1 γενεάς: [ Α ] : [ B ]

Δηλαδή η γυναίκα αυτή μπορεί να αποκτήσει με τον σύζυγο 1, παιδιά με ομάδα αίματος Α ή με ομάδα αίματος Β. Δεν μπορεί να αποκτήσει παιδιά με ομάδα αίματος ΑΒ και παιδιά με ομάδα αίματος 0. Θεωρούμε ότι δεν εμφανίζονται νέες μεταλλάξεις και όλα συμβαίνουν φυσιολογικά.

Β) Ρ2 : Γ1 x Σ2

F1 : Παιδί Β

Δηλαδή : P2 : ii x IAIA ή P2 : ii x IA i

γαμέτες: i , i / IA , IA γαμέτες : i , i / IA , i

F1 :

γαμέτες/ γαμέτες

IA

IA

i

IAi

IAi

i

IAi

IAi

ή

F1 :

γαμέτες/ γαμέτες

IA

i

i

IAi

ii

i

IAi

ii

F1

Γονοτυπική αναλογία : 100% IAi                   ή                  Γονοτυπική αναλογία : ΙΑi : ii

Φαινοτυπική αναλογία : 100 % [A]                  ή                   Φαινοτυπική αναλογία : [Α] : [0]

Επομένως , αναλόγως με τον γονότυπο του συζύγου 2, η γυναίκα αυτή με τον άνδρα αυτό, μπορεί είτε να αποκτήσει μόνο παιδιά με ομάδα αίματος Α ή παιδιά με ομάδα αίματος Α και με ίση αναλογία παιδιά με ομάδα αίματος 0.

Επομένως, με βάση τις παραπάνω, το παιδί Π1 αφού έχει ομάδα αίματος 0 είναι παιδί του Σ2, ο οποίος θα έχει ομάδα αίματος Α και γονότυπο ΙΑi και το παιδί Π2, αφού έχει ομάδα αίματος Β είναι παιδί του Σ1.

Δηλαδή το γενεαλογικό δέντρο είναι :

2017 Blog 8-9-01 extra 2

Γ4

Γνωρίζουμε ότι όλοι οι μικροοργανισμοί όπως και όλα τα έμβια όντα απαιτούν για την ανάπτυξη τους πηγή άνθρακα (C) στο περιβάλλον τους σε κατάλληλες ποσότητες, αφού όλα τα βιολογικά μακρομόρια που δομούν τα κύτταρα (πρωτεΐνες, DNA, RNA, λιπίδια και υδατάνθρακες) αποτελούνται από C. Οι ετερότροφοι μικροοργανισμοί προμηθεύονται από τo περιβάλλον τους τον C, με μορφή οργανικών ενώσεων, ενώ οι αυτότροφοι προμηθεύονται από τον C από τον CO2 της ατμόσφαιρας.

Το βακτήριο E.coli είναι ετερότροφο και απαιτεί ως πηγή άνθρακα είτε γλυκόζη (κατά προτίμηση), είτε λακτόζη, είτε κάποιον άλλον υδατάνθρακα που θα μπορεί να τον μεταβολίσει. Οι Γάλλοι επιστήμονες, Jacob και Monod απέδειξαν ότι το βακτήριο E. coli μπορεί να μεταβολίζει την λακτόζη (δισακχαρίτης αποτελούμενος από γλυκόζη και γαλακτόζη) χάρη στην ύπαρξη στο γονιδίωμα του, του οπερονίου της λακτόζης.

Το οπερόνιο της λακτόζης, απέδειξαν οι Γάλλοι επιστήμονες, ότι αποτελείται από τρία γονίδια που ονομάζονται δομικά ( με τη σειρά: Ζ,Υ,Α) τα οποία βρίσκονται υπό τον έλεγχο του ίδιου υποκινητή. Την έκφραση των δομικών γονιδίων του οπερονίου ελέγχουν δύο ρυθμιστικές αλληλουχίες του. Η μία ονομάζεται χειριστής και βρίσκεται μεταξύ της αλληλουχίας του υποκινητή του οπερονίου, και του πρώτου δομικού γονιδίου Ζ του οπερονίου.

Η άλλη ρυθμιστική αλληλουχία της έκφρασης των δομικών γονιδίων του οπερονίου της λακτόζης, ονομάζεται ρυθμιστικό γονίδιο και βρίσκεται μπροστά από τον υποκινητή του οπερονίου. Το ρυθμιστικό γονίδιο διαθέτει τον δικό του υποκινητή και τις δικές του αλληλουχίες λήξης της μεταγραφής.

Το ρυθμιστικό γονίδιο εκφράζεται συνεχώς και κωδικοποιεί λίγα μόρια μιας πρωτεΐνης, που ονομάζεται πρωτεΐνη καταστολεας. Η πρωτεΐνη αυτή έχει τέτοια στερεοδιάταξη ώστε να αναγνωρίζει την αλληλουχία του χείριστη και να συνδέεται με αυτήν. Η σύνδεση του καταστολέα με τον χειριστή παρεμποδίζει την μεταγραφή των δομικών γονιδίων του οπερονίου της λακτόζης.

΄Όμως, όταν εντός του βακτηρικού κυττάρου υπάρχει λακτόζη, τότε ο ίδιος ο διασακχαρίτης συνδέεται με την πρωτεΐνη καταστολέα σε κατάλληλο σημείο της. Η συνδεση αυτή οδηγεί σε αλλαγή στην στερεοδιάταξη της πρωτεΐνης καταστολέα ώστε αυτή τώρα να μην μπορεί να συνδέεται πλέον με τον χειριστή του οπερονίου. Οπότε, η ίδια η λακτόζη λειτουργεί ως επαγωγέας της έκφρασης των δομικών γονιδίων του οπερονίου, που την καταβολίζει. Δηλαδή, όταν το βακτήριο αναπτύσσεται σε περιβάλλον με μόνη πηγή άνθρακα λακτόζη, εκφράζεται το οπερόνιο της λακτόζης, δηλαδή μεταγράφεται και μεταφράζεται. Με την μεταγραφή του παράγεται ένα μόριο mRNA που φέρει τρεις πληροφορίες για την σύνθεση τριών διαφορετικών πρωτεϊνών (με τη σειρά β-γαλακτοζιδάση, περμεάση, τρανσακετυλάση) κατά την μετάφρασή του, οι οποίες συμμετέχουν στον καταβολισμό της λακτόζης.

Σύμφωνα λοιπόν με τα παραπάνω μπορούμε να ερμηνεύσουμε το δοθέν διάγραμμα, με βάση το οποίο, λίγο πριν την χρονική στιγμή t1, η πηγή άνθρακα του θρεπτικού υλικού έχει εξαντληθεί. Τη χρονική στιγμή t1 προστίθεται λακτόζη στο θρεπτικό υλικό. Μέτα την προσθήκη λακτόζης παρατηρείται σιγμοειδής αύξηση (παρατηρήθηκε εκθετική αύξηση στην παραγόμενη από τα κύτταρα ποσότητα mRNA, μέχρι μία ορισμένη μέγιστη τιμή πέρα από την οποία η ποσότητα του mRNA/βακτήριο δεν αυξάνεται άλλο) στην καμπύλη μεταβολής της συνάρτησης mRNA ανά κύτταρο =f(t).

Μετά την προσθήκη της λακτόζης στην καλλιέργεια την χρονική στιγμή t1, το βακτήριο E.coli άρχισε να εκφράζει το οπερόνιο της λακτόζης και να παράγει το mRNA από την μεταγραφή του, ενώ ταυτόχρονα, επειδή το κύτταρο διαθέτει πλέον πηγή C και επομένως ενέργεια και υλικά για την κάλυψη των αναγκών του και για την σύνθεση των βιολογικών μακρομορίων του, εκφράζει εκτός από το οπερόνιο της λακτόζης και τα υπόλοιπα γονίδια που σχετίζονται με την ανάπτυξη κάθε βακτηρίου για το δεδομένο περιβάλλον όπου αναπτύσσεται. Η παραγωγή των μορίων mRNA θα φτάσει κάποια χρονική στιγμή την μέγιστη δυνατή τιμή πέρα από την οποία δεν μπορεί να αυξηθεί άλλο, αφού αυτές είναι οι μέγιστες ενδογενείς δυνατότητες των βακτηρίων της καλλιέργειας σε αυτό το δεδομένο περιβάλλον.

ΘΕΜΑ Δ

Δ1

Στο φυσιολογικό γονίδιο της αλυσίδας β της αιμοσφαιρίνης Α (HbA) αντιστοιχεί η αλληλουχία ΙΙΙ της δοθείσας εικόνας 4. Στο παθολογικό γονίδιο βς αντιστοιχεί η αλληλουχία Ι της εικόνας 4.

Αιτιολόγηση: Γνωρίζουμε ότι η αιμοσφαιρίνη Α (ΗbA) είναι μία πρωτεΐνη των ερυθρών αιμοσφαιρίων μας, υπεύθυνη για την μεταφορά του οξυγόνου (02 )στους ιστούς. Η αιμοσφαιρίνη Α αποτελείται από 4 πολυπεπτιδικές αλυσίδες 2α και 2β.

Οι αλυσίδες β της ΗbA κωδικοποιούνται από ένα αυτοσωμικό γονίδιο, το γονίδιο β, στο οποίο έχουν βρεθεί περισσότερα από 300 πολλαπλά παθολογικά αλληλόμορφα. Ένα παθολογικό αλληλόμορφο του γονιδίου β είναι το γονίδιο βς το οποίο κωδικοποιεί για τις αλυσίδες βς που συνδεόμενες ανά 2, με 2 αλυσίδες α, δίνουν την μεταλλαγμένη αιμοσφαιρίνη ΗbS, αιτία της ασθένειας της δρεπανοκυτταρικής αναιμίας μίας σοβαρής αυτοσωμικής υπολειπόμενης νόσου.

Η διαφορά της πολυπεπτιδικής αλυσίδας β (φυσιολογική) από της βς (παθολογική ) είναι το 6ο αμινοξύ των πολυπεπτιδίων όπου η β φέρει ως αμινοξύ γλουταμινικό οξύ και η βς φέρει βαλίνη.

Γνωρίζουμε ότι η μεταφορά της γενετικής πληροφορίας από το γονίδιο στην πολυπεπτιδική αλυσίδα γίνεται μέσω της μεταφοράς της πληροφορίας από την μία αλυσίδα του γονιδίου στο κινητό αντίγραφο της γενετικής πληροφορίας, που είναι ένα μονόκλωνο μόριo mRNA, μέσω της διαδικασίας μεταγραφής του γονιδίου. Αντίγραφό λοιπόν της κωδικής αλυσίδας του γονιδίου (που φέρει άμεσα την γενετική πληροφορία του γονιδίου) είναι ένα μόριο mRNA, το οποίο μεταφέρεται στα ριβοσώματα για την παραγωγή του πολυπεπτιδίου, μέσω ενός κώδικα αντιστοίχισης νουκλεοτιδίων mRNA με αμινοξέα πρωτεϊνών (γενετικός κώδικας) χάρη στα μόρια tRNA.

O Γενετικός κώδικας είναι:

α) Τρίλεπτας, τρία νουκλεοτίδια του mRNA κωδικοποιούν ένα αμινοξύ (κωδικόνιο).

β) Συνεχής , κατά την μετάφραση δεν παραλείπεται κανένα νουκλεοτίδιο.

γ) Μη επικαλυπτόμενος, κάθε νουκλεοτίδιο του mRNA που μεταφράζεται ανήκει μόνο σ ένα κωδικόνιο.

δ) Έχει κωδικόνιο έναρξης της μετάφρασης (ΑUG) και κωδικόνιο λήξης της μετάφρασης ένα εκ των (5΄’UAG3 , 5’UAA3, , UGA). Η μετάφραση σταματάει στα κωδικόνια λήξης καθώς δεν υπάρχουν μόρια tRNA με συμπληρωματικά αντικωδικόνια για αυτά τα κωδικόνια.

Σύμφωνα με την διαδικασία της μεταγραφής, το παραγόμενο μονόκλωνο μόριο mRNA, είναι όμοιο σε αλληλουχία και προσανατολισμό, αποτελούμενο βεβαίως από ριβονουκλεοτίδια, με τον ένα από τους δυο κλώνους του γονιδίου. Ο κλώνος αυτός του γονιδίου, ονομάζεται κωδικός και είναι αυτός που φέρει την γενετική πληροφορία όπως και το κινητό αντίγραφο του, το μόριο mRNA. Το μεταγράφημα (mRNA) προέκυψε από την μεταγραφή της συμπληρωματικής προς τον κωδικό κλώνο αλυσίδας του γονιδίου του κυττάρου, η αλυσίδα αυτή ονομάζεται μη κωδική και είναι αυτός ο κλώνος του γονιδίου που χρησιμοποιήθηκε από το ένζυμο της μεταγραφής δηλαδή, την RNA πολυμεράση ως καλούπι για την σύνθεση του mRNA. O κλώνος αυτός δεν φέρει κωδικόνια.

Η RNA πολυμεράση, κατά την μεταγραφή, συνδέεται στον υποκινητή του γονιδίου με την βοήθεια των κατάλληλων μεταγραφικών παραγόντων και ξετυλίγοντας την διπλή έλικα συνθέτει το μόριο RNA με καλούπι της, τη μη κωδική αλυσίδα του γονιδίου. Δημιουργείται έτσι ένα μόριο RNA με προσανατολισμό 5’→3’ , αφού το ένζυμο συνδέει τα ριβονουκλεοτίδια στο αναπτυσσόμενο RNA, με 3’→5’ φωσφοδιεστερικό δεσμό. Επομένως το mRNA που παράγεται κατά την μεταγραφή, έχει προσανατολισμό 5’→3’ με το 5’ άκρο του προς τον υποκινητή του γονιδίου, που μεταγράφεται. Όμοιο προσανατολισμό, έχει και η κωδική αλυσίδα του γονιδίου. Η μη-κωδική αλυσίδα του γονιδίου έχει αντιπαράλληλο προσανατολισμό.

Το αμινοξυ. γλουταμινικο οξύ, κωδικοποιείται απο το κωδικονιο 5’GAG3’ ενώ η βαλινη κωδικοποιείται από το κωδικόνιο 5’GTG3’.

Επομένως στις δοθείσες αλληλουχίες Ι , ΙΙ ,ΙΙΙ της εικόνας 4, προκειμένου να βρούμε την αλληλουχία του φυσιολογικού αλληλόμορφου β και του μεταλλαγμένου αλληλόμορφου βς θα αναζητήσουμε το κωδικόνιο έναρξης 5’ΑΤG3’ σ’ έναν από τους δύο κλώνους, της κάθε αλληλουχίας και για το γονίδιο β θα αναζητήσουμε και ως έβδομο κωδικόνιο το 5’GΑG3’ , ενώ για το παθολογικό αλληλομορφο βς ως έβδομο κωδικόνιο το 5’GTG3’. Γνωρίζουμε ότι κατά την μετα-μεταφραστική τροποποίηση που υφίσταται το παραγόμενο από τη μετάφραση πολυπεπτίδιο του συγκεκριμένου γονιδίου, αφαιρείται η αρχική μεθειονίνη από το αρχικό αμινικό άκρο, δηλαδή το έκτο αμινοξύ, τόσο στο λειτουργικό πολυπεπτίδιο β όσο και στο παθολογικό βς κωδικοποιήθηκε από το έβδομο κωδικόνιο στo mRNA.

Σύμφωνα λοιπόν με τα παραπάνω και τις δοθείσες αλληλουχίες I,II,III της εικόνας 4 παρατηρούμε ότι κωδικονιο έναρξης 5’ΑTG3’ υπάρχει μόνο στην πάνω αλυσίδα, στις αλληλουχίες Ι και ΙΙΙ και στην Ι αλληλουχία το 70 κωδικόνιο είναι το 5’GTG3’ άρα πρόκειται για το γονίδιο βς ενώ στην αλληλουχία ΙΙΙ το 70 κωδικόνιο είναι το GAG3’. Επομένως πρόκειται για το φυσιολογικό γονίδιο β.

Δ2

Η αλληλουχία της εικόνας 4 που απομένει είναι η αλληλουχία ΙΙ και θα μπορούσε να αντιστοιχεί σε γονίδιο που προκαλεί την β-θαλασσαιμία.

Αιτιολόγηση:

Γνωρίζουμε ότι ο γενετικός τόπος του γονιδίου β εμφανίζει περισσότερα από 300 πολλαπλά αλληλόμορφα. Εκείνα τα αλληλόμορφα που φέρουν τέτοια μετάλλαξη, η οποία έχει ως συνέπεια την παντελή έλλειψη της πολυπεπτιδικής αλυσίδας β, είτε έχει ως συνέπεια την μειωμένη παραγωγή της, τα αλληλόμορφα αυτά του γονιδίου β ευθύνονται για την β-θαλασσαιμία μια ασθένεια που εμφανίζει ετερογένεια συμπτωμάτων και προκαλείται από την απουσία ή την μειωμένη παρουσία της ΗbA στα ερυθροκυτταρα του ανθρωπου.

Ένα γονίδιο δεν εκφράζεται όταν δεν είναι δυνατή είτε η μεταγραφή είτε η μετάφραση του. Όταν ένα γονίδιο έχει υποστεί τέτοια μετάλλαξη (μόνιμη αλλαγή στην αλληλουχία του DNA του) που δεν φέρει κωδικόνιο έναρξης 5’ΑΤG3’ , τότε δεν μεταφράζεται το μόριο mRNA που προκύπτει από το γονίδιο αυτό, το οποίο μόριο mRNA αντιστοιχεί στην κωδική αλυσίδα του γονιδίου, όπως αποδείχθηκε στο προηγούμενο ερώτημα.

Παρατηρούμε ότι η αλληλουχία ΙΙ δεν φέρει τριπλέτα 5’ΑΤG3 στον πάνω κλώνο παρά μόνο στον κάτω. Ωστόσο, ο κάτω κλώνος δεν είναι η κωδική αλυσίδα του γονιδίου β, όπως αποδείχθηκε στο προηγούμενο ερώτημα. Συνεπώς, το παραγόμενο κατά την μεταγραφή μόριο mRNA αδυνατεί, να μεταφρασθεί για να παραχθεί το πολυπεπτίδιο β. Συνεπώς, η αλληλουχία β μπορεί να αντιστοιχεί σε ένα παθολογικό αλληλόμορφο γονίδιο β΄ του γονιδίου β, το οποίο παθολογικό β΄ ευθύνεται για την β-θαλασσαιμία.

Παρατηρούμε ότι οι τρεις αλληλουχίες Ι,ΙΙ,ΙΙΙ που μας δίνονται στην εικόνα 4 είναι πολλαπλά αλληλόμορφα του ίδιου γενετικού τόπου. Το αλληλόμορφο β΄( αλληλουχία ΙΙ) εμφανίζει σημειακή μετάλλαξη προσθήκης ενός ζεύγους βάσης ανάμεσα στο 8ο φυσιολογικό ζεύγος βάσεων και στο 90 ζεύγος βάσεων από αριστερά προς τα δεξιά, όπου το ζεύγος C-G έχει προστεθεί στην αλληλουχία ΙΙ .

C

III

G

Η μετάλλαξη αυτή οδηγεί στην κατάργηση του κωδικόνιου έναρξης, που υπάρχει φυσιολογικά στο γονίδιο β, μετά από έξι συνεχόμενες αδενινες, διαβάζοντας από τα αριστερά προς τα δεξιά τον πάνω κλώνο (κωδικό) στις αλληλουχίες Ι και ΙΙΙ που μας έχουν δοθεί και αντιστοιχούν σε τμήμα του 1ου εξωνίου του γονιδίου β της HbA. Αρα το mRNA μόριο που θα προκύψει από την μεταγραφή του γονιδίου β΄(αλληλουχία ΙΙ) δεν θα είναι δυνατόν να μεταφραστεί.

Δ3

α) Η θέση έναρξη της αντιγραφής βρίσκεται στην θέση Υ

β) Συνεχώς αντιγράφεται η αλυσίδα Α.

Ασυνεχώς Αντιγράφεται η αλυσίδα Β.

γ) Το πρωταρχικό τμήμα iii (5’ΑCGCCA3’) συντίθεται πρώτο.

Δ4

Γνωρίζουμε ότι τα άτομα που φέρουν ένα φυσιολογικό β αλληλόμορφο του γονιδίου β που κωδικοποιεί για την πολυπεπετιδικη αλυσίδα β της HbA και ένα παθολογικό υπολειπόμενο β’ ονομάζονται φορείς της ασθένειας της β θαλασσαιμιας και είναι φαινοτυπικά υγιείς σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Επίσης, ετερόζυγα άτομα με γονότυπο ββς , είναι φορείς της δρεπανοκυτταρικής αναιμίας και είναι φαινοτυπικα υγειή άτομα σε χαμηλά υψόμετρα και χωρίς έντονη σωματική άσκηση.

Η β-θαλασσαιμία, όπως και η δρεπανοκυτταρική αναιμία είναι δύο ασθένειες που ελέγχονται από το ίδιο γενετικό τόπο που εδράζεται σε αυτοσωμικό χρωμόσωμα. Η κάθε μία από τις παραπάνω ασθένειες είναι υπολειπόμενες (χαμηλά υψόμετρα) και ελέγχονται από διαφορετικά παθολογικά αλληλόμορφα του γονιδίου β που ευθύνεται για την σύνθεση των φυσιολογικών β-αλυσίδων της ΗbA.

Έστω λοιπόν ο γενετικός τόπος ζεύγους ομόλογων αυτοσωμικών χρωμοσωμάτων όπου εδράζεται το γονίδιο β με πολλαπλά αλληλόμορφα (πάνω από 300). Το γονίδιο β είναι φυσιολογικό και επικρατεί έναντι των παθολογικών υπολειπόμενων αλληλόμορφων του β’ και του βς. Το αλληλόμορφο β ελέγχει την σύνθεση της φυσιολογικής β πολυπεπτιδικής αλυσίδας της ΗbA, το παθολογικό υπολειπόμενο αλληλόμορφο β’ ελέγχει για την παντελή έλλειψη παραγωγής της β αλυσίδας της ΗbA ή για την μειωμένη παραγωγή της, ενώ το παθολογικό υπολειπόμενο βς ελέγχει για την σύνθεση των βς αλυσίδων της ΗbS που προκαλεί την δρεπανοκυταρική αναιμία. Το αλληλόμορφο β’ ευθύνεται για την β-θαλασσαιμία.

Δηλαδή άτομα με γονότυπο ββ είναι υγιή, άτομα με γονότυπο ββς και ββ’ είναι υγιή και ετερόζυγα (φορείς) της δρεπανοκυτταρικής αναιμίας και την β-θαλασσαιμία αντίστοιχα. Τέλος άτομα με το γονότυπο β΄βς νοσούν από μικροδρεπανοκυτταρική αναιμία και άτομα με γονότυπο β’β’ νοσούν από β- θαλασσαιμία

Έχουμε λοιπόν την διασταυρώση :

P: ββ’ x ββς

Γαμέτες : β, β΄ / β, βς

Oι γαμέτες προκύπτουν σύμφωνα με τον 10 νόμο Mendel δηλαδή το νόμο του διαχωρισμού των αλληλόμορφων γονιδίων, σύμφωνα με τον οποίο τα αλληλόμορφα ενός γονιδίου διαχωρίζονται κατά την πρώτη μειωτική διαίρεση και κατανέμονται τυχαία αλλά ισοπίθανα στους γαμέτες. Η γονιμοποίηση είναι τυχαίο γεγονός.

F1 : Οι απόγονοι προκύπτουν σύμφωνα με το αβάκιο του Punnett, το οποίο αποτελεί την διαγραμματική απεικόνιση των γαμετών και του τρόπου συνδυασμού τους σε μία διασταύρωση.

F1 :

γαμέτες/ γαμέτες

β

β΄

β

ββ

ββ’

βς

ββς

βςβ’

Γονοτυπική αναλογία F1 : ββ : ββ’ : ββς : βςβ’

Δηλαδή από την διασταύρωση αυτή προκύπτουν είτε άτομα με γονότυπο ββ είτε με ββ’ είτε με ββς είτε άτομο που φέρει και τα δύο παθολογικά αλληλόμορφα.

Από τον ιστότοπο βιολογίας: www.nikimargariti.com.

Διαγώνισμα Κεφάλαιο 6 Μεταλλάξεις Βιολογία Θετικού Προσανατολισμού

Ζήτημα 1ο                                                                                                                  Μονάδες 25

Α. Επιλέξτε την ορθή απάντηση:

  1. Πόσα αντίγραφα του γονίδιου των αλυσίδων δ διαθέτουμε φυσιολογικά στα χρωμοσώματα μας, σε ένα ευθροκύτταρο μας, που κυκλοφορεί στο αίμα μας:

α. 2 β. 4   γ. 6  δ. 12  ε.0

  1. Ένα ενήλικο ετερόζυγο άτομο με γονότυπο ββς έχει τις εξής αιμοσφαιρίνες:

α. HbA, HbS, HbF, HbA2

β. HbA, HbS, HbF, HbA2 και μπορει και HbAS

γ. HbA, HbS

δ. HbS, HbF

ε. HbA, HbS, HbA2

  1. Έμβρυο 18 εβδομάδων με γονότυπο ββς διαθέτει τις εξής πολυπεπτιδικές αλυσίδες για τις αιμοσφαιρίνες του.

α. α,β,γ

β. α,γ,δ

γ. α,γ

δ. α,β,δ

ε. β,δ,γ

  1. Ένα άτομο με σύνδρομο Klinefelter, διαθέτει:

α. Φυσιολογικό πλήθος αλληλομόρφων γονίδιων.

β. Διπλάσιο πλήθος όλων των γονίδιων που εδράζουν στα φυλετικά χρωμοσώματα

γ. Δυο αντίγραφα για κάθε αυτοσωμικό γονίδιο, δυο αντίγραφα για το γονίδιο της αιμοροφίλιας και τρία αντίγραφα για κάθε γονίδιο που εδράζεται στην ομόλογη περιοχή των φυλετικών χρωμοσωμάτων.

δ. Τέσσερα γονίδια α, δυο γονίδια β, δυο γονίδια γ, δυο γονίδια δ στην φάση G1 του κυτταρικού κύκλου.

ε. Υψηλά επίπεδα HbF εάν έχει γονότυπο ομόζυγο για το γονίδιο βς και εμφανίζει ανθεκτικότητα στην προσβολή από το πλασμώδιο.

  1. Άτομο με γονότυπο ααααββςγγδδ, διαθέτει:

α. HbA 100%

β. HbS 100%

γ. ΗbS & HbA σε αναλογία 1:1

δ. Σε συνθήκες έλλειψης οξυγόνου όλα τα κύτταρα των ερυθρών αιμοσφαιρίων δρεπανώνονται.

ε. Οι δυο νόμοι του Μέντελ, ισχύουν για το σύνολο των αναφερόμενων γονίδιων.

Ζήτημα 2ο                                                                                                                  Μονάδες 25

  1. Μια γυναίκα κυοφορεί ένα έμβρυο. Στον καρυότυπο που πραγματοποιήθηκε διαπιστώθηκε ότι διαθέτει 45 χρωμοσώματα καθώς απουσίαζε ένα φυλετικό χρωμόσωμα και διέθετε μόνο ένα Χ φυλετικό, ενώ εμφανίζει και φαινοτυπικά χαρακτηριστικά συνδρόμου Down.

α. Τι είδους μεταλλάξεις φέρει το έμβρυο; (2)

β. Ποιος από τους δυο γονείς μπορεί να ευθύνεται για το σύνδρομο τις μονοσωμίας; Με ποιο τρόπο μπορεί να προέκυψε ο μεταλλαγμένος γαμέτης; (1 + 5)

γ. Το έμβρυο εμφανίζει μειωμένα επίπεδα αιμοσφαιρίων. Δώστε μια πιθανή εξήγηση για την εμφάνιση του φαινομένου Down και των μειωμένων επιπέδων των αιμοσφαιρνών  στο έμβρυο. (7)

  1. Ποιες μεταλλάξεις χαρακτηρίζονται ως διπλασιασμός; Αναφέρετε τρία παραδείγματα γονίδιων που ο διπλασιασμός αποτέλεσε στην μια περίπτωση θετικής μετάλλαξης και στις άλλες περιπτώσεις αρνητική μετάλλαξη. (2+3)
  2. Συγκρίνετε τους μηχανισμούς προστασίας από τις μεταλλάξεις μεταξύ των προκαρυωτικών και των ευκαρυωτικών κυττάρων. (5)

Ζήτημα 3ο                                                                                                                  Μονάδες 25

  1. Δίνεται η παρακάτω μεταλλαγμένη αλληλουχία του γονιδίου β των αλυσίδων β των αιμοσφαιρινών μας (αλληλόμορφο Const. Christine). Στην αλληλουχία των 95 νουκλεοτιδίων που δίνεται δεν εμφανίζεται κωδικόνιο λήξης, ούτε κάποιο εσώνιο.

GGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTGTTGGG…95 ΝΟΥΚΛΕΟΤΙΔΙΑTGTTTAGTGATGGCCTGGCTGATCACCTGGA 3′

α. Σύμφωνα με τον γενετικό κώδικα, ποιο κωδικόνιο και ποιο αμινοξύ βρίσκεται και κωδικοποιείται  αντιστοίχως , ακριβώς πριν από την έναρξη των 95 νουκλοτιδίων; (2)

β. Προσδιορίστε την θέση του υποκινητή του μεταλλαγμένου γονιδίου β. (1)

γ. Αυτό το μεταλλαγμένο αλληλόμορφο, φέρει μια σημειακή μετάλλαξη αντικατάστασης βάσης, σε σχέση με το αλληλόμορφο βς. Ποια είναι αυτή η αλλαγή; Ποιο αμινοξύ κωδικοποιείται ; (2)

δ. Προσδιορίστε το αμινοξύ που κωδικοποιείται από το κωδικόνιο που ακολουθεί την αλληλουχία των 95 νουκλεοτιδίων. (2)

2.

α. Σε ένα άτομο πάρθηκαν δείγματα μυϊκού ιστού και πραγματοποιήθηκε καρυότυπος. Τα αποτελέσματα έδειξαν τρεις διαφορετικούς καρυοτύπους, σε τρία διαφορετικά κύτταρα του.

α. ΧΟ+44  β. ΧΥ+44    γ. ΧΥΥ+44. Εξηγήστε πως είναι δυνατόν να υπάρξει τέτοιο άτομο. (5)

β. Εξηγήστε αν είναι δυνατόν να προκύψουν μονοζυγωτικά δίδυμα διαφορετικού φύλου.(5)

 

 Ζήτημα 4ο                                                                                                                  Μονάδες 25

 

Δίνεται το παρακάτω γενεαλογικό δένδρο:

2017 Κεφάλαιο 6 Μεταλλάξεις blog-01

Το ζευγάρι ΙΙΙ1 x ΙΙΙ2 απέκτησε τρία παιδία, τα οποία: Το πρώτο εμφανίζει ελαφριάς μορφής ανομίας, το δεύτερο παιδί βαριά μορφή β-θαλασσαιμία και μικρό ποσοστό δρεπανοκυττάρων κατά τη δοκιμασία δρεπάνωσης, ενώ εμφανίζει και υψηλή συγκέντρωση HbF και τέλος το τρίτο παιδί  εμφάνισε στους πρώτους μήνες της ζωής του πολύ βαριά μορφής αναιμία, ενώ στις κυτταρολογικές εξετάσεις εμφανίστηκαν πολύ υψηλού επιπέδου ποσοστά δρεπανοκυττάρων.

Έγιναν μοριακές εξετάσεις τόσο για την β-θαλασσαιμία όσο και για την δρεπανοκυτταρική αναιμία. Τα αποτελέσματα φαίνονται στα παρακάτω πηκτώματα αγαρόζης.

Η απόσταση της θέσης  περιορισμού NhdI από την θέση περιορισμού MstII, είναι 20 ζεύγη βάσεων το οποίο δεν αποδίδεται στο σχήμα.

2017 Κεφάλαιο 6 Μεταλλάξεις blog-02

Οι μοριακές εξετάσεις έγιναν για το γονίδιο της δρεπανοκκυτταρικής αναιμίας. Χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση MstII, η οποία κόβει το παθολογικό αλληλόμορφο.

Για την β θαλασσαιμία χρησιμοποιήθηκε η περιοριστική ενδονουκλεάση  NhdI, η οποία πέπτει το φυσιολογικό αλληλόμορφο εντός της 5’ αμετάφραστης περιοχής του γονίδιου και αφήνει ανέπαφο το παθολογικό αλληλόμορφο. Η επιλογή της NhdI, έγινε δεδομένου ότι το άτομο ΙΙ1 έπασχε από πολύ βαριά μορφή β-θαλασσαιμίας και είχαν ελεγχθεί σε προγενέστερο μοριακό έλεγχο, τα υπεύθυνα  γονίδια του. Κανένα άτομο της γενεαλογίας δεν εμφάνισε α-θαλασσαιμία.

Α. Με βάση τα αποτελέσματα του μοριακού έλεγχου προσδιορίστε τους γονότυπους των ατόμων του δένδρου που ελέγχθηκαν με μοριακές εξετάσεις ως προς την HbA. (5)

  1. Προσδιορίστε την πιθανότητα εμφάνισης που είχε το άτομο IV2. (3)

Γ. Εξηγήστε πως μπορεί να προέκυψε το άτομο IV3, τι είδους μεταλλάξεις συνέβησαν.(4)

Δ. Προσδιορίστε τον γονότυπο των ατόμων ΙΙΙ1 και ΙΙΙ2 ως προς τα γονίδια των αιμοσφαιρίνων  HbA2, HbF. Γνωρίζετε ότι το άτομο IV1 εμφανίζει ελαφριά μορφή αναιμίας, παρόλο που είναι ετερόζυγο, επειδή σε περαιτέρω βιοχημικές αναλύσεις διαπιστώθηκε ότι δεν ανιχνεύεται HbA2. (2)

Ε. Πιο θα είναι το πρότυπο των ζωνών του γονίδιου βς στο πήκτωμα αγαρόζης, όταν αυτό πέτεται ταυτοχρόνως με τις περιοριστικές ενδονουκλεάσες MstII & NhdI ;(3)

ΣΤ. Γνωρίζουμε ότι τα ώριμα ερυθρά αιμοσφαίρια δεν διαθέτουν πυρήνα, διαθέτουν όμως ριβοσωμάτα. Είναι τα ώριμα ερυθρά αιμοσφαίρια ζωντανά κύτταρα; (3)

Παρακάτω δίνεται τμήμα του 1ου εξωνίου του γονιδίου για τη β-αλυσίδα της αιμοσφαιρίνης HbA. Κάθε τμήμα προέρχεται από διαφορετικό αλληλόμορφο.

Γονίδιο βi

AGGCTTATGGTGCACCTTACGCCAGAGGAG

TCCGAATTACCACGTGGAATGCGGTCTCCTC

Γονίδιο βii

AGGCTTATGGTGCACCTTACGCCAGTGGAG

TCCGAATACCACGTGGAATGCGGTCACCTC

Γονίδιο βiii

AGGCTTATGGTGCACCTTACGCCAGTAGGAG

TCCGAATACCACGTGGAATGCGGTCATCCTC

Γονίδιο βiv

AGGCTTATCGGTGCACCTTACGCCAGAGGAG

TCCGAATAGCCACGTGGAATGCGGTCTCCTC

Να βρεθεί το είδος της γονιδιακής μετάλλαξης για τα  παθολογικά αλληλόμορφα γονίδια.

Ποιό είναι το γονίδιο βς ; (4+1)

Διαγώνισμα Προσομοίωσης Βιολογίας Θετικού Προσανατολισμού 2017

Ζήτημα.                                                                                                                         μονάδες 25

1.Τα χρωμοσώματα των ευκαρυωτικών οργανισμών είναι ουδέτερα τόσο χημικά όσο και ηλεκτρικά, αυτό σημαίνει ότι:

Α. οι ιστόνες είναι θετικά φορτισμένες και όξινες

Β. οι ιστόνες είναι αρνητικά φορτισμένες και όξινες

Γ. οι ιστόνες είναι θετικά φορτισμένες και βασικές

Δ. οι ιστόνες είναι αρνητικά φορτισμένες και βασικές

Ε. τίποτα από τα παραπάνω

Στ. όλα τα παραπάνω είναι δυνατά.

2. Στο εργαστήριο απομονώθηκαν παγκρεατικά κύτταρα και μυικά  κύτταρα ποντικού. Μέτα από κατάλληλα πειράματα προέκυψαν υβριδικά κύτταρα, στα οποία όταν δημιουργήθηκε η cDNA βιβλιοθήκη τους σε δυο διαφορετικές χρονικές στιγμές, πήραμε ώριμα mRNA που κωδικοποιούν  για ινσουλίνη και ώριμα mRNA που κωδικοποιούν για μυοσίνη την πρώτη φορά και ώριμα mRNA που κωδικοποιούν  κατά κύριο λόγο μόνο μυοσινη τη δεύτερη φορά.

Α. Τα υβριδικά κύτταρα μπορεί να προέκυψαν από την σύντηξη πυρήνων.

Β. τα υβριδικά κύτταρα μπορεί να προέκυψαν από απομάκρυνση του πυρήνα του παγκρεατικού πυρήνα και τοποθέτηση του πυρήνα του μυϊκού κυττάρου στο απύρηνο παγκρεατικό κύτταρο.

Γ. τα υβριδικά κύτταρα μπορεί να προέκυψαν από μεταφορά πρωτεϊνών μυϊκών κυττάρων σε παγκρεατικά.

Δ. τα υβριδικά κύτταρα εκφράζουν τα ίδια γονίδια κάθε χρονική στιγμή

Ε. το α ή το β

Στ. το γ ή το δ.

3. Δημιουργήθηκε ένας σύνθετος βακτηριοφάγος με πρωτεϊνικό καψίδιο του Τ4 και γενετικό υλικό του λ φάγου. Οι σύνθετοι αυτοί ιοί χρησιμοποιήθηκαν για την δημιουργία γονιδιωματικής βιβλιοθήκης του βακτηρίου A. tumefaciens. Η γονιδιωματική βιβλιοθήκη αποτελείται από:

Α. λ φάγους το DNA των οποίων είναι ανασυνδυασμένο με τμήμα από Ti πλασμίδιο και το χρωμόσωμα του βακτηρίου.

Β. Τ4 φάγους το γενετικό υλικό των οποίων είναι ανασυνδυασμένο με τμήματα από το ολικό DNA του βακτηρίου.

Γ. λ φάγους που φέρουν ανασυνδυασμένο γενετικό υλικό του Τ4 με τμήμα από το DNA του βακτηρίου δότη.

Δ. Τ4 φάγους και λ φάγους ο κάθε ιός με το δικό του DNA ανασυνδυασμένο με τμήμα από το γενετικό υλικό του βακτηρίου .

Ε. τίποτα από τα παραπάνω.

Στ. οποιοδήποτε από τα παραπάνω είναι μπορεί να είναι σωστό.

4. Δίνεται το ολιγόπεπτιδίο :

met-lys-pro-arg-ser-arg-ile-phe-glu-met

Το συνεχές γονίδιο που το κωδικοποιεί πέπτεται από την EcoRI. To μεταφράσιμο τμήμα της κωδικής αλυσίδας είναι:

Α. 5’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG3’

B  5.’ ATG-GAA-TTC-ATT-AGG-TCC-AGG-CCC-AAA-ATG3’

Γ. 5’ ATG-AAG-CTT-TTA-GGA-CCT-GGA-CCC-AAA-ATG3’

Δ. 3’ ATG-AAA-CCC-AGG-TCC-AGG-ATT-TTC-GAA-ATG5’

E. καμιά από τις παραπάνω επιλογές.

Στ. οποιαδήποτε από τις παραπάνω επιλογές.

5. Τα αντισώματα είναι πρωτεΐνες με τεταρτοταγή δομή αποτελούνται από 4 πολυπεπτιδικές αλυσίδες ανά δυο όμοιες. Δυο βαριές και δυο ελαφριές. Τα μη μονοκλωνικά αντισώματα είναι διαφορετικά μεταξύ τους μόνο σε ένα μικρό ακραίο τμήμα τόσο των βαρίων όσο και των ελαφριών αλυσίδων τους. Ο ανθρωπινός οργανισμός μπορεί να συνθέσει εκατομμύρια διαφορετικά αντισώματα. Τα μονοκλωνικά αντισώματα παράγονται με τεχνολογία υβριδωμάτων και όχι με γενετική μηχανική από γενετικά τροποποιημένα βακτήρια ή ευκαρυωτικά κύτταρα, διότι:

α. είναι πιθανόν αδύνατη η απομόνωση των δυο διαφορετικών ωρίμων mRNA από ένα β λεμφοκύτταρο που απαιτούνται για την cDNA βιβλιοθήκη.

Β. είναι πιθανόν αδύνατη η εκτέλεση των πολύπλοκων μετά-μεταφραστικών τροποποιήσεων που απαιτούνται από τα βακτήρια καθώς και η in vitro εκτέλεση τους.

Γ. για να γίνει η απομόνωση ωρίμων mRNA πρέπει να γνωρίζουμε τα γονίδια που τα κωδικοποιούν και αυτά δεν είναι μέχρι σήμερα γνωστά.

Δ. τίποτα από τα παραπάνω.

Ζήτημα 2.                                                                                                                     Μονάδες 25 

1. Από πρόδρομα ερυθρά αιμοσφαίρια απομονώνουμε mRNA  που κωδικοποιεί τη β αλυσίδα της αιμοσφαιρίνης Α και το βάζουμε σε εκχύλισμα βακτηριακών κυττάρων. Παρατηρούμε σύνθεση πρόδρομων β αλυσίδων της αιμοσφαιρίνης Α;  (μονάδες 2)              Αιτιολογήστε την απάντηση σας. (μονάδες 5)

2. Θα μπορούσε να αναπτυχθεί η τεχνολογία του ανασυνδυασμένου DNA αν ο γενετικός κώδικας δεν ήταν καθολικός; (μονάδες 7)

3.  Δώστε τον ορισμό της βιοτεχνολογίας. (μονάδες 6)

4. Δίνεται ο παρακάτω πινάκας, να γίνουν οι σωστές αντιστοιχήσεις. (μονάδες 5)

2017 Προσομοίωση πίνακας

Ζήτημα 3.                                                                                                                        Μονάδες 25

Σε μια προσπάθεια γεωπόνων βιοτεχνολόγων για την παραγωγή άνθεων με εντονότερο χρώμα, το δίκλωνο DNA που κωδικοποιεί την συνθετάση της χαλκόνης (ένζυμο υπεύθυνο για την παραγωγή μοβ χρωστικής των άνθεων της πετούνιας), τέθηκε υπό τον έλεγχο του πολύ ισχυρού υποκινητή 35S του ιού της μωσαϊκωσης (ιογενής ασθένεια) της πετούνιας, ο οποίος είχε ενθεθεί στο Ti. Στη συνεχεία, με τη βοήθεια του Ti πλασμίδιου και του βακτηρίου A. tumefanciens, το γονίδιο της συνθετάσης, μαζί με τον υποκινητή του ιού μεταφέρθηκε σε φυτά πετούνιας μοβ χρώματος. Το πλασμίδιο Ti, περιείχε γονίδιο ανθεκτικότητας στην καναμυκινή, για την επιλογή των φυτών που δέχθηκαν το ανασυνδυασμένο Ti. Το Ti έφερε μια θέση αναγνώρισης για το περιοριστικό ένζυμο EcoRI εντός του γονιδίου της ανθεκτικότητας στην καναμυκίνη.

Η υπερέκφραση του ενζύμου της συνθετάσης της χαλκόνης στην πετούνια, είχε ως αποτέλεσμα, όχι απαραιτήτως την παραγωγή άνθεων με βαθύτερο χρώμα, όπως θα περιμέναμε, αλλά και φυτών που έφεραν λευκά άνθη. Για να διαπιστωθεί το πρότυπο της κληρονόμησης  του ετερόλογου γονιδίου, έγινε ανάδρομη διασταύρωση των λευκών διαγονιδιακών απόγονων με το πατρικό φυτό, που έφερε ομοιόμορφα μοβ άνθη. Παραγόταν φυτά μοβ με ποσοστό 50% και φυτά λευκά κατά 50%. Ενώ από την διασταύρωση φυτών με βαθύ μοβ χρώμα και φυσιολογικών μοβ πήραμε 50% φυσιολογικά και 50% διαγονιδιακά μοβ.

Σημείωση: θεωρούμε ότι κάθε κύτταρο λαμβάνει από ένα πλασμίδιο Τi.

α. Περιγράψτε την διαδικασία με την οποία οι επιστήμονες δημιούργησαν διαγονιδιακά φυτά πετούνιας ξεκινώντας από την δημιουργία cDNA βιβλιοθήκης. (μονάδες 10)

β. Για ποιο λόγο το δίκλωνο ετερόλογο γονίδιο τέθηκε υπό τον έλεγχο του υποκινητή 35S του ιού της μωσαϊκώσης της πετούνιας όταν ενθέθηκε στο Ti πλασμίδιο, για ποιο λόγο δεν επιλέχθηκε ο υποκινητής του γονιδίου της χαλκόνης; (μονάδες 5)

γ. Δώστε την ερμηνεία για την μη αναμενόμενη εμφάνιση φαινοτύπων στα διαγονιδιακά φυτά. (μονάδες 10)

Ζήτημα 4.                                                                                                                Μονάδες 25

Δίνεται το παρακάτω γενεαλογικό δένδρο το οποίο αφορά την κληρονόμηση δυο ασθενειών στον άνθρωπο. Την ασθένεια του υποφυσιακού νανισμού και την συνδυασμένη εγκεφαλομυοπάθεια.

2017 Προσομοίωση-02

Προκείμενου να βρεθεί ο τρόπος κληρονόμησης της συνδυασμένης εγκεφαλομυοπάθειας πάρθηκε μυϊκός ιστός από το άτομο ΙΙΙ6, στον οποίο πραγματοποιήθηκε βιοψία και μοριακές αναλύσεις. Γνωρίζουμε ότι σύμφωνα με τις βιοψίες η ασθένεια της μυοπάθειας δεν εμφανίζει κανένα από τα γνωστά πρότυπα, ωστόσο, εμφανίζει τροποποιημένα μιτοχόνδρια, έτσι έγινε PCR ενίσχυση και πέψη με περιοριστικές ενδονουκλεάσες για τα γονίδια ND1 και ND6 του mtDNA.

Το φυσιολογικό ND1 γονίδιο δεν πέπτεται από την EcoRI, ενώ το παθολογικό αλληλόμορφο πέπτεται σε ένα σημείο. Η ίδια περιοριστική ενδονουκλεάση πέπτει το φυσιολογικό ανθρωπινό mtDNA σε ένα ακόμη σημείο.

Το φυσιολογικό αλληλόμορφο ND6 του mtDNA, πέπτεται από την PstI, ενώ το παθολογικό αλληλόμορφο όχι.

Στο ακόλουθο σχήμα δίνεται ο χάρτης περιορισμού του ανθρώπινου mtDNA, το οποίο έχει μέγεθος 17.000 ζ.β.

Δίνεται η θέση αναγνώρισης της PstI:

5’ CTGCAG3’

3’ GACGTC5’

2017 Προσομοίωση-03

Πάρθηκαν δείγματα από τα εξής άτομα της γενεαλογίας :

Ι1, Ι2, ΙΙ1, ΙΙ3, ΙΙ5, ΙΙΙ5, ΙΙΙ6, ΙΙΙ7

To mtDNA, κάθε ατόμου πέπτεται με EcoRI και PstI, ταυτόχρονα και πήραμε τα ακόλουθα αποτελέσματα. Το κυκλικό μόριο δεν εμφανίζεται.

2017 Προσομοίωση-04

Από περαιτέρω γενετικές μελέτες που έγιναν αποκλείστηκε οποιαδήποτε σχέση αυτόσωμικών γονιδίων με την μυοπάθεια.

α.Με ποιο τρόπο κληρονομείται η ασθένεια του υποφυσιακού νανισμού σύμφωνα με το γενεαλογικό δένδρο ποια διασταύρωση αποδεικνύει αυτόν τον τρόπο κληρονόμησης;      ( μονάδες 2)

β. προτείνεται ένα τρόπο κληρονόμησης ή εμφάνισης της μυοπάθειας στο άτομο που εμφανίζει τη νόσο (μονάδες 8). Με ποια πιθανότητα ένα επόμενο παιδί των ΙΙ5 και ΙΙ6 θα νοσεί (μονάδες 2);

γ. Σχεδιάστε τον περιοριστικό χάρτη του mtDNA του ατόμου Ι1 και του ατόμου Ι2 (μονάδες 3).

δ.Εξηγήστε ποια είναι η κωδική και η μη κωδική αλυσίδα των γονιδίων ND1 και ND6. Να προσδιοριστεί ο προσανατολισμός των κλώνων των δυο γονιδίων (μονάδες 6).

2017 Προσομοίωση-05

ε.Τι είδους μετάλλαξη φέρει το παθολογικό γονίδιο ND1 (μονάδες 1).

στ. Προσδιορίστε τον προσανατολισμό του μορίου mtDNA του ανθρώπου στο σημείο Α (εκατέρωθεν αυτού) (μονάδες 1).

ζ.Οι ασθένειες που μελετώνται έχουν τις προϋποθέσεις για την θεραπεία τους μέσω γονιδιακής θεραπείας (μονάδες 2);

Διαγώνισμα κεφαλαίου 7 Βιολογίας Θετικού Προσανατολισμού

Ζήτημα 1                                                                    μονάδες 25

A.Επιλέξτε την σωστή πρόταση:                                                        μόρια 15

1. Τα μικροβιακά κύτταρα για να διαιρεθούν :

1. Πρέπει να έχουν το κατάλληλο μέγεθος και αρκετή ενέργεια.

2. Πρέπει να έχουν ιδανικό περιβάλλον

3.Να έχει ολοκληρωθεί χρονικό διάστημα 20 λεπτών

4. Πρέπει να έχουν τον κατάλληλο ρυθμό ανάπτυξης

2. Όλα τα κύτταρα μια μικροβιακής καλλιέργειας διαιρούνται συγχρόνως.

Το βακτήριο Thermus aquaticus από το οποίο λαμβάνουμε την Taq DNA πολυμεράση που εκτελεί την αντιγραφή στο PCR, δεν μπορεί:

1.Να καλλιεργηθεί σε στερεό θρεπτικό υλικό

2.Να καλλιεργηθεί σε υγρό θρεπτικό υλικό

3.Να συντηρηθεί στους -80οC

4.Να επωαστεί σε κλίβανο

3. Η βιοτεχνολογία:

1.Ανακαλύφθηκε από τον Ούγγρο K. Ereky

2.Ανακαλύφθηκε από τον Γάλλο L. Pauster

3.Αναπτύχθηκε σημαντικά μετά την ανάπτυξη της Γενετικής Μηχανικής

4.Αφορά αποκλειστικά τους μικροοργανισμούς

4.Η απόδειξη του ημισυντηριτικού μηχανισμού της αντιγραφής πραγματοποιήθηκε σε συνθήκες:

1.Θερμοκρασία 37 βαθμοί Κελσίου, pH=7, αερόβια

2.Θερμοκρασία 25 βαθμοί Κελσίου, pH=5,5, αερόβια

3.Θερμοκρασία 37 βαθμοί Κελσίου , pH=5,5, αναερόβια

4.Θερμοκρασία -80 βαθμοί Κελσίου, pH=7, αναερόβια

5.Το βακτήριο E. coli διαιρείται κάθε 20’ σε μια καλλιέργεια, ο μέγιστος πληθυσμός είναι χ κύτταρα και μετά από 3 ώρες καλλιέργειας ο πληθυσμός βρίσκεται στην εκθετική με χ/2 πλήθος κυττάρων, πόσο χρόνο χρειάζεται ακόμη η καλλιέργεια για να επιτύχει τον μέγιστο πληθυσμό;

1.Χ’

2.20’

3.3 ώρες

4.χ/2 ώρες

 

Ερωτήσεις σωστού- λάθους: μόρια 10

  1. Τα βακτήρια και οι μονοκύτταροι ευκαρυώτες διαιρούμενα πολλαπλασιάζονται.
  2. Οι ανεξαιρέτως οι μικροοργανισμοί χρειάζονται C, H, O, N, P, S.
  3. Η στερεή καλλιέργεια εμφανίζει λανθάνουσα εκθετική, στατική και φάση θανάτου.
  4. Η στερεή καλλιέργεια αποτελείται από αποικίες ενώ η υγρή αποτελείται από ανεξάρτητα αιωρούμενα κύτταρα.
  5. Όλοι οι μικροοργανισμοί χρειάζονται τα ίδια μίκρο και ιχνοστοιχεία σε διαφορετικές όμως συγκεντρώσεις, αναλόγως με την σύσταση και την λειτουργία των κυττάρων τους.
  6. Τα αυτότροφα μικρόβια απορροφούν ανόργανο C και τον μετατρέπουν σε οργανικές ενώσεις
  7. Οι αναερόβιοι μικροοργανισμοί δεν μπορούν να καλλιεργηθούν σε στέρεες καλλιέργειες.
  8. Τα αντιβιοτικά παράγονται κατά την στατική φάση από μη γενετικώς τροποποιημένα βακτήρια, κυρίως και χρησιμοποιούνται στην ιατρική για να σκοτώσουν άλλα μικρόβια.
  9. Σε μια συνεχή καλλιέργεια το περιβάλλον ανάπτυξης των μικροβίων στο βιοαντιδραστήρα είναι πάντα ιδανικό.
  10. Τα κύτταρα που εκτελούν ζύμωση, εκτελούν αναερόβιο μεταβολισμό, η ζύμωση όμως για μια καλλιέργεια μικροβίων είναι η υγρή ή η στερεή καλλιέργεια τους.

Ζήτημα 2                                                                         μονάδες 25

1.Δίνεται το παρακάτω τρυβλίο με δύο διαφορετικές αποικίες του βακτηρίου D. Pneumoniae.

Διαγώνισμα Κεφ 7 blog-01

α. Ποια αποικία αφορά ποιο από τα δυο διαφορετικά στελέχη του υπό μελέτη βακτηρίου;

β. Εξηγήστε που οφείλεται αυτή η διαφορά των δυο στελεχών του ίδιου είδους μικροοργανισμών.

γ. Ποιο από τα δυο είδη θα είχε κατά την γνώμη σας μεγαλύτερα ποσοστά επιτυχίας κατά την   in vitro  διαδικασία μετασχηματισμού για την πρόσληψη πλασμιδιακού φορέα κλωνοποίησης;

δ. Εξηγήστε την απάντηση σας.                            μόρια (1,1,1,1,2) 5

2.Δίνονται παρακάτω τα βήματα που απαιτούνται για την εργαστηριακής κλίμακας στερεή καλλιέργεια ενός είδους μικροοργανισμού.

Τοποθετήστε τα στην σωστή σειρά.

  1. Επώαση σε κλίβανο
  2. παρασκευή κατάλληλου για τον μικροοργανισμό υγρού θρεπτικού υλικού
  3. απομόνωση μικροοργανισμών από το φυσικό του ενδιαίτημα
  4. εμβολιασμός του θρεπτικού υλικού
  5. διατήρηση της καλλιέργειας για μακρό χρονικό διάστημα στους -80 βαθμούς Κελσίου
  6. προσθήκη άγαρ
  7. ρύθμιση pH του θρεπτικού υλικού
  8. αποστείρωση του υλικού ανάπτυξης (μόρια 8)

3. Ποιες είναι οι συνθήκες που πρέπει να ελέγχονται για την ανάπτυξη μικροοργανισμών σε βιοαντιδραστήρες; (μόρια 4)

Για ποιο λόγο είναι απαραίτητη η διασφάλιση συνθηκών ασηψίας; (μόρια 3)

4. Ποια από τις παρακάτω καμπύλες δεικνύει την συνάρτηση N=f(t), όπου Ν ο πληθυσμός των μικροβιακών κυττάρων σε μια συνεχή καλλιέργεια  ; μόρια 1

Διαγώνισμα Κεφ 7 blog-02

Αιτιολογήστε την απάντησή σας. (μόρια 4)

 

Ζήτημα 3                                                                         μονάδες 25

Δίνεται το παρακάτω διάγραμμα dN/dt=f(t), το οποίο περιγράφει τη μεταβολή της ταχύτητας ανάπτυξης ενός μικροβιακού πληθυσμού σε συνάρτηση με τον χρόνο.

Διαγώνισμα Κεφ 7 blog-03

Εξηγήστε:

Αν η καλλιέργεια είναι υγρή ή στερεή, κλειστή ή συνεχής. (μόρια 6)

2. Δώστε μια εξήγηση γιατί ένα βακτήριο που φυσιολογικά απομονώνεται από το έδαφος στο επίπεδο της ριζόσφαιρας (θέση ανάπτυξης ριζών των φυτών, όπου υπάρχει περιορισμένη συγκέντρωση οξυγόνου), δεν μπορεί να αναπτυχθεί ικανοποιητικά στο εναέριο περιβάλλον. (μόρια 6)

Τα κύτταρα μιας αποικίας εκφράζουν όλα τα ίδια γονίδια;

Αιτιολογήστε την απάντηση σας. (μόρια 2 και 5)

4. Σε ένα μικροβιακό πληθυσμό που βρίσκεται στην εκθετική φάση μιας κλειστής καλλιέργειας όλα τα κύτταρα βρίσκονται σε αυτή τη φάση και κανένα δεν βρίσκεται σε διαφορετική φάση; Αιτιολογήστε την απάντηση σας.  (μόρια 2 και 4)

 

Ζήτημα 4                                                                         μονάδες 25

Στο παρακάτω γράφημα παρουσιάζεται η διακύμανση του πλήθους ενός βακτηριακού είδους. Για το είδος αυτό θέλουμε να μελετήσουμε την ανθεκτικότητα του σε δυο διαφορετικά αντιβιοτικά, την νεομυκίνη (Νeo) και την χλωραφαινικόλη (Chl), σε δυο διαφορετικές συγκεντρώσεις για το καθένα. Γνωρίζουμε ακόμη ότι το βακτηριακό αυτό είδος σε υψηλή θερμοκρασία θανατώνεται.

Διαγώνισμα Κεφ 7 blog-04

Το βακτηριακό είδος έχει τη δυνατότητα σε χαμηλές θερμοκρασίες, χαμηλότερες των 10 βαθμών Κελσίου να μειώνει στο ελάχιστο τον μεταβολισμό του.

Σημείωση: Η μελέτη της καλλιέργειας ξεκινάει από την χρονική στιγμή t  στο μέσο της εκθετικής φάσης για θερμοκρασία 37,5 βαθμών Κελσίου που είναι ιδανική για αυτό το μικροβιακό είδος.

t0 – θερμοκρασία 37,5 βαθμοί Κελσίου.

t1- θερμοκρασία 5 βαθμοί Κελσίου

t2- θερμοκρασία 28 βαθμοί Κελσίου

t3-10mg/mL Νεομυκίνη

t4-25mg/mL Νεομυκίνη

t5-0,1mg/mL Χλωραφαινικόλη

t6-0,5mg/mL Χλωραφαινικόλη

t7- θερμοκρασία 80 βαθμοί Κελσίου

  1. Εξηγήστε τις διάφορές στην κλίση της καμπύλης της εκθετικής φάσης για τα χρονικά διαστήματα t0 -> t1, t1->t2, t2->t3 και t7->t8
  2. Ποια είναι η ανθεκτικότητα του βακτηριακού είδους έναντι του αντιβιοτικού της νεομυκίνης;
  3. Για ποιο λόγο σε μοριακό επίπεδο κάποια από τα κύτταρα της βακτηριακής καλλιέργειας δεν επιζούν παρουσία 10mg/mL, αλλά κάποια άλλα κύτταρα επιζούν παρουσία 25mg/mL;
  4. Εξηγήστε την συμπεριφορά του βακτηριακού είδους έναντι του αντιβιοτικού της χλωραφαινικολής στις διαφορετικές δόσεις.
  5. Για ποιο λόγο το βακτηριακό είδος εμφανίζει διαφορετική συμπεριφορά έναντι των δυο αντιβιοτικών. (μόρια 20)

2.Δίνονται οι παρακάτω καμπύλες που παρουσιάζουν την συνάρτηση μεταβολής του πληθυσμού για το βακτήριο E. coli σε θερμοκρασία α. 36,6 και β. 39 βαθμοί Κελσίου, ενώ όλοι οι υπόλοιποι παράγοντες διατηρούνται σταθεροί και ιδανικοί για την ανάπτυξη του μικροβίου σε συνεχή καλλιέργεια. Εξηγήστε γιατί ο χρόνος διπλασιασμού της καλλιέργειας είναι αντιστρόφως ανάλογος του ρυθμού ανάπτυξης του. (μόρια 5)

Διαγώνισμα Κεφ 7 blog-05

Διαγώνισμα βιολογίας θετικού προσανατολισμού. Κεφάλαια: 1-2-4-7

Ζήτημα 1.                                                                                                   Μονάδες 25

  1. Δίνεται το παρακάτω σχήμα που αναπαριστά ένα χρωμόσωμα.

Επαναληπτικό 1-2-4-7-01

Το τμήμα Α θέλουμε να κλωνοποιηθεί in vitro.  Η αντιγραφή τελειώνει κάθε φορά στο τέλος του μητρικού κλώνου που λειτουργεί ως καλούπι.

Μετά από πόσους κύκλους αντιγραφής θα υπάρχει στον δοκιμαστικό σωλήνα για πρώτη φορά το επιθυμητό τμήμα Α.

α. Νo x 2κ

β. 2κ

γ. κ

δ.2

ε. 3

  1. Το τμήμα Α αποτελεί γονίδιο. Το προϊόν της μεταγραφής διαθέτει 70% πουρίνες, από αυτές το 30% δημιουργεί δυο δεσμούς υδρογόνου σε δίκλωνο μόριο. Γνωρίζετε ακόμη ότι η πουρίνη που σχηματίζει δυο δεσμούς υδρογόνου και συμμετέχει στο μεταγράψιμο τμήμα, του γονιδίου Α στην μη κωδική αλυσίδα, αποτελεί το 20% του κλώνου αυτού, στο γονίδιο Α.

Ο λόγος A+T/G+C του γονιδίου Α είναι (στον μη κωδικό κλώνο) στο τμήμα που αντιπροσωπεύεται στο προϊόν της μεταγραφής, μετά την ολοκλήρωση της διαδικασίας.

α. περίπου 7/3

β.1

γ. περίπου ½

δ. περίπου 2/3

ε. Δεν υπολογίζεται

  1. Για την μεταγραφή αυτού του γονιδίου απαιτήθηκε να ξετυλιχθούν 14 νουκλεοσώματα, στα οποία συμπεριλαμβάνονται και εκείνα στα σημεία Μ και Ν, που φαίνονται στην εικόνα 1. Το μήκος του RNA που παράχθηκε αποτελείται από 2746 νουκλεοτίδια. Το χρωμόσωμα έχει μήκος 2 χ 106 ζ.β. και ξεκινάει και τελειώνει με νουκλεόσωμα.  Ποιο είναι το πλήθος των ιστόνων που απαιτούνται για το πακετάρισμα του;

α.  περίπου 2 χ 104

β. περίπου 16 χ 104

γ. περίπου 8 χ 104

δ. 32 χ 104

ε. περίπου 106

  1. Το μεταφράσιμο τμήμα του γονιδίου Α αποτελείται από 600 κωδικόνια. Η 5’ αμετάφραστη περιοχή του, προκαλεί τη δημιουργία συμπλόκου έναρξης με τέτοιο ρυθμό ώστε το αμέσως προηγούμενο ριβόσωμα να έχει ήδη μεταφράσει 10 κωδικόνια μέχρι να συνδεθεί το επόμενο μόριο tRNA σε αυτό . Πόσα   πλήρη ριβοσώματα θα αποτελούν το πολύσωμα του mRNA του γονιδίου Α όταν το πρώτο ριβόσωμα έχει ολοκληρώσει την πολυπεπτιδική αλυσίδα;

α. 60

β.65

γ. 66

δ. 59

ε. 66,6

  1. Η θέση Ε που φαίνεται στο σχήμα έχει την αλληλουχία:

5’ ——————–GGAATTCC——————-3’

3’———————CCTTAAGG——————5’

Α. Υπάρχει η περιοριστική ενδονουλεάση MdI, η οποία αναγνωρίζει την παραπάνω αλληλουχία οκτώ νουκλεοτιδίων και πέμπτει τους φωσφοδιεστερικούς δεσμούς 5’-G-G-3’ καθώς και τους 14 δεσμούς υδρογόνου μεταξύ των παρεμβαλλόμενων ζευγών βάσεων. Πάσα διαφορετικά τμήματα που περιέχουν το γονίδιο Α προκύπτουν μετά την πέψη του χρωμοσώματος με τα ένζυμα EcoRI και MdI, ταυτόχρονα;

α. 1

β.2

γ. 3

δ. 4

ε. Κανένα.

Β. Το διπλανό πλασμίδιο χρησιμοποιήθηκε ως φορέας κλωνοποίησης του τμήματος Α. Πόσα διαφορετικά ανασυνδυασμένα πλασμίδια μπορούν να προκύψουν;

Δίνεται ο φορέας κλωνοποίησης  που θα χρησιμοποιηθεί.

Επαναληπτικό 1-2-4-7-02

α. 1

β. 2

γ. 3

δ.4

ε. Κανένα.

Ζήτημα 2.                                                                                           Μονάδες 25

  1. Να αναφέρετε τους λόγους για τους οποίους το βακτήριο Ε. coli χρησιμοποιείται ως οργανισμός μοντέλο της Μοριακής Βιολογίας. (μόρια 4)
  2. Εξηγήστε για ποιο λόγο προσθέτουμε αζωτούχες και φωσφορικές ενώσεις στις πετρελαιοκηλίδες που πρόκειται να «καθαριστούν» με την δράση μικροοργανισμών οι οποίοι μεταβολίζουν το πετρέλαιο.  (μόρια 5)
  3. Κατατάξτε τα γονίδια των οργανισμών ως προς τη θέση τους στο κύτταρο και ως προς τη θέση του γενετικού τους τόπου. (μόρια 5)
  4. Στην εικόνα 1 φαίνεται ένα μέρος μιας βιολογικής διαδικασίας που βρίσκεται σε εξέλιξη.

CUCUUTCT

GAGAAACATGCATACGAC                    Εικόνα 1

α. Να εντοπίσετε τη βάση που ενσωματώθηκε κατά παράβαση του κανόνα της συμπληρωματικότητας.               (μόρια 2)

β. Να γράψετε το τελικό δίκλωνο μόριο, το οποίο θα παραχθεί στο τέλος της διαδικασίας που απεικονίζει η εικόνα 1. (μόρια 3)

γ. Να σημειώσετε τον προσανατολισμό των αλυσίδων του μορίου αυτού.              (μόρια 1)

  1. Τα παρακάτω βήματα περιγράφουν μια εργαστηριακή καλλιέργεια μικροοργανισμών. Να τοποθετήσετε τα βήματα στη σωστή σειρά, γράφοντας μόνο τον αντίστοιχο αριθμό. α.προετοιμασία κατάλληλων θρεπτικών υλικών β. εμβολιασμός μικρής ποσότητας του μικροοργανισμού γ. απομόνωση οργανισμού στο εργαστήριο δ. ανάπτυξη καλλιέργειας σε κατάλληλες συνθήκες ε. αποστείρωση θρεπτικών υλικών και μέσων.           (μόρια 5)

Ζήτημα 3.                                                                                                    Μονάδες 25

  1. Δίνονται τα παρακάτω τρία σχήματα, δυο από αυτά αφορούν ακριβώς το ίδιο τμήμα ενός κλώνου ενός μορίου DNA σε διαφορετικές χρονικές στιγμές του κυτταρικού κύκλου ενός ευκαρυωτικού κυττάρου, στο οποίο ανήκει αυτός ο κλώνος DNA. Το τρίτο σχήμα αφορά την ίδια ακριβώς διαδικασία με μια από τις δυο διαδικασίες in vivo που δίνονται. Η διαδικασία που παριστάνεται στο τρίτο σχήμα πραγματοποιείται in vitro.

Επαναληπτικό 1-2-4-7-03

Α. Ποιες διαδικασίες αφορούν τα σχήματα 1, 2 και 3;

Β. Να ονομάσετε τις πρωτεΐνες α,β,γ,δ και ε.

Γ. Ποια είναι η λειτουργία του σημείου 1 στο μόριο του DNA;

Ποιες διαφορές γνωρίζετε μεταξύ των σημείων 1 στο μόριο του DNA ανάμεσα στους προκαρυωτικούς και τους ευκαρυωτικούς οργανισμούς;

Υπάρχουν διαφορές μεταξύ των δυο κατηγοριών οργανισμών που αναφέρθηκαν και για τις πρωτεΐνες α, που αναγνωρίζουν τα σημεία όπως το 1;

Δ. Τι είδους βιολογικά μακρομόρια είναι οι κλώνοι ι και ιι καθώς και ιιι;

Ποια δομική διαφορά εντοπίζεται μεταξύ των κλώνων ι και ιιι;

Ε. Ποιες πρωτεΐνες έδρασαν και ποιες πρόκειται να δράσουν ακόμη εκατέρωθεν του σημείου 2;

ΣΤ. πόσες πρωτεΐνες έδρασαν στο σημείο 3; Ονομάστε τις πρωτεΐνες αυτές.

Ζ. Ποιες από τις πρωτεΐνες που εμφανίζονται στα σχήματα εκτελούν εργασίες που έχουν το ίδιο τελικό αποτέλεσμα;

Η. Σε ποιο από τα τρία σχήματα γνωρίζετε ότι ένα προκαρυωτικό ένζυμο  «διαβάζει» ευκαρυωτικό γενετικό υλικό;

Θ. Ποια από τις διαδικασίες που φαίνονται στα σχήματα εκτελείται μια φορά στο δεδομένο τμήμα DNA, στην ζωή του κυττάρου;

Ι. Εξηγήστε τις πρακτικές εφαρμογές που βρίσκει η διαδικασία η οποία εκτελείται in vitro.                                                                                         (μόρια 1.5, 1.5, 1, 2, 2, 1, 2, 1, 1, 1)

  1. Σε ένα εργαστήριο Μοριακής Βιολογίας, επαναλήφθηκαν τα πειράματα που απέδειξαν τον μετασχηματισμό των προκαρυωτικών κυττάρων.

Οι οργανισμοί μελετήθηκαν με σύγχρονα μέσα και τεχνικές που μας παρέχει η τεχνολογία του ανασυνδυασμένου DNA.

Οι επιστήμονες δημιούργησαν την γονιδιωματική βιβλιοθήκη των δυο στελεχών του βακτηρίου D. pneumoniae και απομόνωσαν το γονίδιο που κωδικοποιεί για την πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος στα λεία στελέχη.

Στην συνέχεια με τεχνικές Γενετικής Μηχανικής μετασχημάτισαν ένα πληθυσμό από αδρά στελέχη του βακτηρίου. Από τον πληθυσμό που μετασχηματίστηκε και τον αρχικό πληθυσμό των λείων βακτηρίων, λήφθηκε δείγμα κυττάρων, στο οποίο πραγματοποιήθηκε PCR για την ενίσχυση του γονιδίου που ελέγχει για το κάλυμμα, από το γονιδίωμα των βακτηρίων. Τα αποτελέσματα αναλύθηκαν και πήραμε τα εξής:

Επαναληπτικό 1-2-4-7-04

Α. Ποιο από τα βακτηρία που αναλύθηκαν είναι το αδρό , ποιο το λείο και ποιο το μετασχηματισμένο αδρό σε λείο;                                                                         (μόρια 1,5)

Β. Δίνεται ο ένας από τους δύο κλώνους του γονιδίου που ενισχύθηκε και δυο μόρια tRNA που μετείχαν στην μετάφραση του.

5′ …TCAATTAGTGTACCCTTTATGATCACCTGGGTACATTGATTAGAT…3′

3′ UUA5′ και 5′ GUA 3′  τα αντικωδικόνια των δυο μορίων tRNA .

Ο κλώνος που δίνεται είναι ο κωδικός ή ο μη κωδικός του γονιδίου;

Αιτιολογήστε την απάντηση σας.                                                                           (μόρια 1 και 1,5)

Γ. Γνωρίζετε ότι μεταξύ της αλληλουχίας αναγνώρισης του mRNA από την μικρή ριβοσωμική υπομονάδα και του κωδικονίου έναρξης υπάρχουν τέσσερα νουκλεοτίδια της 5′ αμετάφραστης περιοχής. Ποια θα είναι η αλληλουχία της κωδικής αλυσίδας του γονιδίου rRNA που θα συνδέεται με το μόριο mRNA το οποίο θα προκύπτει κατά την μεταγραφή του δοθέντος γονιδίου;                                                                                                                  (μόρια 1)

Δ. Τα αδρά στελέχη του D. pneumoniae,  που χρησιμοποιήθηκαν για να μετασχηματιστούν δεν διαθέτουν πλασμίδια και είναι ανθεκτικά στο αντιβιοτικό τετρακυκλίνη (tet). Οι ερευνητές είχαν στην διάθεσή τους, τους παρακάτω φορείς κλωνοποίησης.

Ποιον  μπορούν επιλέξουν για να επιτύχουν τον μετασχηματισμό;

Αιτιολογείστε την απάντηση σας.                                                                            (μόρια 1 και 2,5)

Επαναληπτικό 1-2-4-7-05

Όπου: Polilynker: Πολλές, διαδοχικές, αλληλεπικαλυπτόμενες, μοναδικές θέσεις αναγνώρισης περιοριστικών ενδονουκλεασών. Τουλάχιστον μια από αυτές είναι κατάλληλη για την ένθεση του επιθυμητού γονιδίου.

Ε. Τα ανασυνδυασμένα βακτήρια καλλιεργήθηκαν στο εργαστήριο και πήραμε τις παρακάτω καμπύλες: Βιομάζα = f(t) και Πρωτεΐνη που ευθύνεται για την δημιουργία του καλύμματος = f(t).

Επαναληπτικό 1-2-4-7-06

Γνωρίζουμε ότι το γονίδιο του λείου πνευμονιόκοκκου που ανασυνδυάστηκε, διαθέτει μια θέση περιορισμού NdeI, εντός του μεταφράσιμου τμήματος του. Μια καλλιέργεια,  όπως η παραπάνω (διάγραμμα 2), παρουσίασε την εξής εικόνα ως προς την παραγωγή της ετερόλογης πρωτεΐνης από τα μετασχηματισμένα αδρά στελέχη.

Μέτα από την απομόνωση των κυττάρων της καλλιέργειας και στη συνέχεια την απομόνωση των γονιδίων από τους πλασμιδιακούς φορείς κλωνοποίησης και στην  περαιτέρω πορεία πέψης του γονιδίου που ευθύνεται για το κάλυμμα των λείων στελεχών του πνευμονιόκοκκου από την NdeI, έδειξε ότι τα μισά γονίδια μπορούσαν να κοπούν και τα άλλα μισά όχι. Εξηγήστε σύντομα το φαινόμενο. Είναι γνωστό ότι  η καλλιέργεια δεν εκτέθηκε σε κανέναν  εξωγενή μεταλλαξιγόνο παράγοντα και  θεωρούμε ότι σε κάθε κύτταρο ξενιστή εισέρχεται μόνο ένα πλασμίδιο φορέας κλωνοποίησης, το οποίο αντιγράφεται μόνο μια φορά εντός του ξενιστή του.                                                    (μόρια 2,5)

Ζήτημα 4ο                                                                                                   Μονάδες 25

  1. Ένα στέλεχος E. coli, μετασχηματίζεται με το γονίδιο που ευθύνεται για το κάλυμμα (κάψα) του λείου στελέχους του πνευμονόκοκκου. Για τον μετασχηματισμό χρησιμοποιήθηκαν τρεις διαφορετικοί φορείς κλωνοποίησης, όπως φαίνονται παρακάτω και δημιουργηθηκαν τρεις διαφορετικες υγρες καλλιεργειες των μετασχηματισμενων κυτταρων που η καθεμιά έχει μετασχηματιστεί με διαφορετικό  φορέα κλωνοποίησης. Οι καλλιέργειες αναπτύσσονται αρχικά σε γλυκόζη και μετά την εξάντληση της, η αύξηση της κάθε καλλιέργειας συνεχίζεται με λακτόζη. Σε ποια χρονική στιγμή αναμένεται να εκφράζεται η ετερόλογη πρωτεΐνη σε καθεμιά από τις τρεις καλλιέργειες;
  2. Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-08Επαναληπτικό 1-2-4-7-07

2. Δίνονται οι παραπάνω καμπύλες α, β, γ που αφορούν τρεις διαφορετικές υγρές καλλιέργειες. Ποια από αυτές αντιστοιχεί στην αύξηση της καλλιέργειας E. coli, σε υγρό θρεπτικό υλικό με πηγή άνθρακα  λακτόζη, ποια με γλυκόζη και ποια με γαλακτόζη. Γνωρίζεται ότι σε κάθε μια από τις καλλιέργειες η πηγή άνθρακα βρίσκεται σε ίσες συγκεντρώσεις  με τις υπόλοιπες καλλιέργειες που εξετάζονται;

Δίνεται ακόμη ότι το βακτήριο E. coli, μπορεί να προσλάβει και να μεταβολίσει την γαλακτόζη. Η γαλακτόζη εντός του κυττάρου μετατρέπεται μετά από τρία μεταβολικά βήματα σε 6-φωσφόρο-γλυκόζη που αποτελεί το προϊόν και του πρώτου μεταβολικού βήματος της καταβολικής οδού διάσπασης της γλυκόζης στο κύτταρο.

 

 

 

Βιολογία Ομάδας Θετικού Προσανατολισμού Πανελλήνιες Εξετάσεις 2016

Για καλούς λύτες;

 

Η Βιολογία Ομάδας θετικού Προσανατολισμού, όπως ακριβώς όφειλε ως το μάθημα με τον υψηλότερο συντελεστή (1,3), που καθορίζει το 1/3 (33%) της συνολικής βαθμολογίας του υποψηφίου για τα τμήματα της τριτοβάθμιας εκπαίδευσης των επιστήμων ζωής, μεταξύ των οποίων συγκαταλέγονται και οι περιζήτητες Ιατρικές σχόλες, φαίνεται ότι αποτέλεσε φέτος το φίλτρο επιλογής για τους φετινούς υποψηφίους, που από τον Σεπτέμβριο θα καθίσουν στα έδρανα των αμφιθεάτρων των ιατρικών σχολών.

Ωστόσο, και φέτος τα θέματα δεν στερούνταν δυστυχώς αστοχιών και προχειρότητας.

Πράγματι, αν προσέξουμε τα θέματα, έχουμε:

Θέμα Α. Ερώτημα Α3:

Τα σωματικά κύτταρα του προβάτου Dolly περιείχαν:

α. ανασυνδυασμένο DNA

β. Το σύνολο του γενετικού υλικού του κυττάρου του μαστικού αδένα εξάχρονου προβάτου που χρησιμοποιήθηκε στη διαδικασία της κλωνοποίησης.

γ. το γονίδιο που είναι υπεύθυνο για την σύνθεση  της α1-αντιθρυψίνης

δ. το μιτοχονδριακό DNA του ωαρίου στο οποίο τοποθετήθηκε ο πυρήνας του κυττάρου του μαστικού αδένα του εξάχρονου προβάτου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το κεφάλαιο 9, την διαδικασία κλωνοποίησης, και τον ορισμό και την δημιουργία διαγονιδιακών ζώων.

Από το κεφάλαιο 1 ότι τα μιτοχόνδρια είναι μητρικής προέλευσης.

Από το κεφάλαιο 4 τον ορισμό του ανασυνδυασμένου DNA.

Θα έπρεπε όμως, να γνωρίζει την θέση των μιτοχονδρίων στα κύτταρα και ποια κύτταρα διαθέτουν μιτοχόνδρια, γνώσεις που απέκτησε από την Β’ λυκείου.!

Όμως στην σελίδα 149 του σχολικού βιβλίου της Β’ λυκείου, υπάρχει το ένθετο με τίτλο ΝΤΟΛΥ. Το ένθετο αυτό στην τελευταία παράγραφο του αναφέρει:” Το μητρικό πρόβατο είχε αποκτήσει με την βοήθεια της Γενετικής Μηχανικής , την ιδιότητα να παράγει γάλα με ινσουλίνη. Η ιδιότητα αυτή πέρασε φυσικά και στην κόρη της την Ντόλυ.”

Ποια είναι λοιπόν η σωστή απάντηση που πρέπει να επιλέξει ο μαθητής, η α ή η δ; Μήπως είναι και τα δυο;

Ένας μαθητής οφείλει να γνωρίζει από την Β’ λυκείου που βρίσκονται τα μιτοχόνδρια ώστε μπορεί να αποκλείσει το β, άλλα δεν πρέπει να γνωρίζει τι λέει το σχολικό βιβλίο της β’ λυκείου για την Ντόλυ;;;

Θέμα Β. Ερώτημα Β1:

DNA δεσμάση:

Α. δημιουργία φωσφοδιεστερικών δεσμών;

Β. διασπάση φωσφοδιεστερικών δεσμών;

Γ. ούτε Α ούτε Β

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου στο συγκεκριμένο ένζυμο, στο δεύτερο και στο τέταρτο κεφάλαιο (δεν αναφέρεται πουθενά αλλού στο σχολικό της τρίτης λυκείου, ούτε και σε άλλο σχολικό βιβλίο μικρότερων τάξεων).

Όμως, από αυτές τις αναφορές ο μαθητής δεν μπορεί να συμπεράνει ποια είναι η δράση της δεσμάσης και τι είδους δεσμούς δημιουργεί!!!

Επομένως ποια είναι η σωστή αντιστοίχηση, με το Α που είναι πράγματι το επιστημονικώς ορθο, το οποίο όμως, πως θα το εξάγει ο μαθητής από το σχολικό βιβλίο; Ή μήπως σωστή, πρέπει να θεωρηθεί και η Γ, αφού δεν μπορεί να γνωρίζει αν συγκεκριμένα δημιουργεί φωσφοδιεστερικούς δεσμούς?

Είναι ιδιαιτέρως αξιοπρόσεκτο δε, το γεγονός ότι,στα θέματα του 2015 στο τρίτο θέμα που αφορούσε τα ένζυμα της αντιγραφής που δρούν στο σημείο σύνδεσης του πρωταρχικού τμήματος που αντικαταστάθηκε με δεοξυνουκλεοτίδια, με το τμήμα DNA του θυγατρικού κλώνου, το οποίο δημιούργησε η DNA πολυμεράση ως προϊόν επιμήκυνσης νωρίτερα αυτού του πρωταρχικού τμήματος, η περυσινή ΚΕΕ δεν ζητούσε και την δεσμάση!

Φέτος όμως ,η ΚΕΕ απαιτεί να γνωρίζει ο μαθητής τι είδους δεσμούς δημιουργεί η δεσμάση!!!! Πόσο άραγε θα έχουν μπερδευτεί τα παιδιά που ξαναδίνουν φέτος;;;;

Δηλαδή, πέρυσι η ΚΕΕ εκτίμησε ότι ο μαθητής δεν μπορεί να συνάγει τον ρόλο της δεσμάσης από το σχολικό βιβλίο, αλλά φέτος με το ίδιο ακριβώς σχολικό βιβλίο πιστεύει ότι ο μαθητής μπορεί να το συνάγει!!

Ερώτημα Β2: Τι είναι ο καρύοτυπος; Να αναφέρετε δυο (2) συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου ενός ανθρώπου.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το πρώτο κεφάλαιο την διαδικασία δημιουργίας του καρυοτύπου (για να ξέρει ότι τα χρωμοσώματα είναι μεταφασικά και την διαζώνωση με την χρώση Giemsa), τον ορισμό του καρυοτύπου, την αναφορά του σχολικού βιβλίου στα αυτοσωμικά και φυλετικά χρωμοσώματα του ανθρώπου.

Από το έκτο κεφάλαιο, τις δυνατότητες διάγνωσης των αριθμητικών και των δομικών χρωμοσωμικών ανωμαλιών, τόσο στα τμήματα του βιβλίου που αναφέρονται οι μεταλλάξεις αυτές όσο και στο ειδικότερο τμήμα του σχολικού βιβλίου στο έκτο κεφάλαιο που αναφέρετε στις διαγνωστικές τεχνικές και στον προγενετικό έλεγχο. Επίσης θα έπρεπε (ή μήπως και να μην έπρεπε ; ) να έχει μελετήσει τον πινάκα 6.1 του σχολικού βιβλίου.

Από τα παραπάνω και δεδομένης της ασάφειας της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να αναφέρει διάφορους συδυασμούς από δυο συμπεράσματα που μπορούν να εξαχθούν από την μελέτη του καρυοτύπου του ανθρώπου. Ας ελπίσουμε ότι η σωστή απάντηση δεν είναι ο μαναδικός συνδυασμός που σκέφτηκε η ΚΕΕ.

Αξίζει και εδώ να παρατηρήσουμε , όπως και στην περίπτωση της δεσμάσης, την έλλειψη πρωτοτυπίας του θέματος που αφορά τον καρυύτυπο, με το περυσινό τέταρτο ζήτημα στις πανελλήνιες του 2015 που αφορούσε και πάλι τον καρυότυπο. Αλλά και εδώ, όπως και στην δεσμάση, τα φετινά ζητούμενα αναιρούν τα περυσινά ζητούμενα σε σχέση με τον καρυότυπο όπως και στην περίπτωση της δεσμάσης.

Πιο συγκεκριμένα:

Πέρυσι η ΚΕΕ θεωρούσε δεδομένο από την εκφώνηση στο Δ1 ότι είναι δομική μετάλλαξη η ανάστροφη λιγότερων από δέκα νουκλεοτιδίων (ερχόμενη σε πλήρη αντίθεση τον ορισμό του βιβλίου)!!! Και ζητούσε από τα παιδιά να γράψουν ως σωστή απάντηση (και την δεχόταν ως σωστή!) ότι είναι δυνατή η παρατήρηση αυτής της μετάλλαξης στον καρυότυπο, όταν το σχολικό βιβλίο αναφέρει ότι τα νουκλεοσώματα που αποτελούνται από 146 ζεύγη βάσεων παρατηρούνται μόνο στο ηλεκτρονικό μικροσκόπιο και ότι ο καρυότυπος παρατηρείται στο οπτικό μικροσκόπιο!!!!

Η εκφώνηση δε, τουΔ4 το 2015 έλεγε:”Να εξηγήσετε το είδος ή τα είδη των δομικών χρωμοσωμικών ανωμαλιών, που σίγουρα θα έχει κάθε απόγονος με μη φυσιολογικό καρυότυπο”.

Εν ολίγης, ο μαθητής πέρυσι την ώρα των εξετάσεων  “έμαθε” ότι οι ανάστροφες τμημάτων DNA μεγέθους μικρότερου των 10 ζευγών βάσεων οδηγούν σε μη φυσιολογικό καρυότυπο και άρα παρατηρούνται στον καρυότυπο!!!

Εάν φέτος ο ίδιος μαθητής ξαναδίνει πανελλήνιες εξετάσεις και γράψει αυτό που “ έμαθε” πέρυσι θα θεωρηθεί σωστό από την ΚΕΕ και αν όχι, γιατί;

Σημείωση: Το πρόβλημα του μεγέθους των γονιδίων και των μεγάλων αλληλουχιών, μπορεί πολύ εύκολα να αντιμετωπιστεί με την ενδιάμεση  ύπαρξη, … , όπως χρησιμοποιήθηκε φέτος για την 5′ αμετάφραστη περιοχή, όχι όμως για το γονίδιο, το οποίο φυσικά δεν μπορεί να είναι τόσο μικρό  όσο δόθηκε. Ευτυχώς πάντως που χρησιμοποιήθηκε τουλάχιστον για την 5′ αμετάφραστη, ώστε να μην υπάρξουν τα προβλήματα που εμφάνιζε το Δ θέμα το 2014 με την 5′ αμετάφραστη περιοχή των 4 νουκλεοτιδίων στο mRNA, στο οποίο μάλιστα μπορούσε να συνδεθεί το ριβόσωμα κατά την ΚΕΕ!

Θέμα Γ. Ερώτημα Γ1: Να γράψετε στο τετράδιο  σας τον γονότυπο του ατόμου Ι 1 που βρίσκεται  στο γενεαλογικό δένδρο 1 και να αιτιολογήσετε την απάντησή σας.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Στο πέμπτο κεφάλαιο, την αναφορά του σχολικού βιβλίου για τις  ομάδες αίματος, τον πρώτο νόμο του Μέντελ, και την αναφορά του βιβλίου για τα γενεαλογικά δένδρα.

Σύμφωνα με αυτές τις γνώσεις αυτές και με βάση τα δεδομένα του γενεαλογικού δένδρου που δόθηκε, δεν υπάρχει μόνο ένας γονότυπος για το άτομο Ι1 αλλά δύο! Ποια είναι λοιπόν η σωστή απάντηση;

Η εύκολη λύση είναι όλα σωστά, αδικώντας τους μαθητές που βρήκαν και τις δυο λύσεις! Όμως σε διαφορετική περίπτωση αδικούν τους μαθητές που βρήκαν και τους δυο τρόπους άλλα έγραψαν μόνο τον ένα, αφού έναν τους ζητάει η εκφώνηση.

Η πιο σωστή λύση είναι να είναι απλώς ορθά διατυπωμένη η ερώτηση για να μην προκύπτουν τέτοια ζητήματα.

Ερώτημα Γ5: “ Βρέθηκε ότι στελέχη … αυτές οι μεταλλάξεις”.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Την αναφορά του σχολικού βιβλίου της Γ’ λυκείου στο δεύτερο κεφάλαιο, για την δομή και την λειτουργιά του οπερονίου.

Ακόμη από το δεύτερο κεφάλαιο την διαδικασία της μεταγραφής.

Επίσης από το έκτο κεφάλαιο τον ορισμό των μεταλλάξεων, τα είδη των μεταλλάξεων και ειδικότερα τις επιπτώσεις των γονιδιακών μεταλλάξεων στα γονίδια και στα προϊόντα τους.

Σύμφωνα με αυτές τις γνώσεις τις οποίες υποτίθεται ότι είναι οι μόνες που μπορεί να έχει και στις οποίες εξετάζεται, ο μαθητής ,εξάγει ότι οι μεταλλάξεις είναι τυχαία γεγονότα, που συμβαίνουν χωρίς σκοπιμότητα και οδηγούν σε απρόβλεπτα αποτελέσματα τόσο για το DNA, όσο και κατ΄ επέκταση για το γονιδιακό προϊόν των μεταλλαγμένων γονιδίων, άρα και για το κύτταρο. Επιπρόσθετα, συνάγει  ότι καθορισμένες αλληλουχίες DNA (π.χ υποκινητές) εμφανίζουν συγγένεια με κατάλληλες πρωτεΐνες (π.χ. μεταγραφικοί παράγοντες, καταστολέας οπερονίου). Αντιλαμβάνεται λοιπόν ο μαθητής, ότι αλλαγές είτε στην αλληλουχία του DNA,  είτε στην στερεοδιάταξη της κατάλληλης πρωτεΐνης δεν επιτρέπουν την σύνδεση της πρωτεΐνης με το DNA.

Επομένως, ανεξάρτητα από τον πραγματικό ορθό τρόπο λειτουργίας του οπερονίου της λακτόζης στο E.coli, ο οποίος δεν περιγράφεται  εξάλλου με λεπτομέρειες στο σχολικό, ο μαθητής μπορεί να υποθέσει διάφορες πιθανές περιπτώσεις που μπορούν να έχουν συμβεί και δεν εκφράζεται το οπερόνιο της λακτόζης στα δεδομένα στελέχη του βακτηρίου.

Ποιές θα θεωρηθούν σωστές και με ποια κριτήρια;

Οι “σωστές” απαντήσεις είναι άραγε μόνο όσες σκέφτηκαν οι θεματοδότες και ο λύτης; Αν είναι έτσι, πρέπει κάνεις να αναρωτηθεί αν στο μάθημα της Βιολογίας (δυστυχώς, όχι μόνο φέτος) τα παιδιά εξετάζονται πράγματι στη Βιολογία που διδάσκονται στο σχολείο (μόνο στην Γ ‘ Λυκείου;) ή μήπως στην μαντική τέχνη;

Σημείωση: Για την δομή του οπερονίου αξίζει κάνεις να προσέξει το κείμενο του βιβλίου, άλλα και την περίληψη του βιβλίου στο σημείο αυτό.

Θέμα Δ. Ερώτημα Δ3: Να γράψετε την αλληλουχία των βάσεων του mRNA, θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας, του γονιδίου της εικόνας 2.

Για να απαντήσει ο μαθητής πρέπει να γνωρίζει:

Από το δεύτερο καφάλαιο την διαδικασία της μεταγραφής, της ωρίμανσης και της μετάφρασης των γονιδίων των ευκαρυώτικων οργανισμών.

Σύμφωνα λοιπόν με τα παραπάνω και με δεδομένη την εκφώνηση της ερώτησης, που ζητάει το τμήμα του μορίου του ωρίμου mRNA που θα χρησιμοποιηθεί κατά την μετάφραση της πληροφορίας του γονιδίου που δόθηκε, η απάντηση που πρέπει να δώσει ο μαθητής είναι: Το ώριμο mRNA μέχρι και το κωδικόνιο λήξης ,εκτός της  υπόλοιπης 3′ αμετάφραστης περιοχής καθώς το σχολικό βιβλίο αλλα ούτε και κάποιο άλλο σχολικό βιβλίο βιολογίας προηγούμενων τάξεων, αναφέρει τον ρόλο της 3′ αμετάφραστης περιοχής του mRNA. Επομενως ο μαθητής προκείμενου να αποφύγει το λάθος να γράψει κάτι που δεν ξέρει αν χρησιμοποιείται στην μετάφραση, μπορεί να επιλέξει να μην το γράψει μόνο και μόνο για να είναι σύμφωνος με ότι τον ερωτάνε.

Ποια είναι λοιπόν η σωστή απάντηση; Αυτή που προκύπτει σύμφωνα με όσα αναλύθηκαν παραπάνω ή απλώς η σωστή απάντηση είναι για μια ακόμη άφορα αυτή και μόνο αυτή που σκέφτηκε ο λύτης των θεμάτων, πριν αυτά δοθούν στους μαθητές;

Ερώτημα Δ5: Στην εικόνα 4…ii) θέση 2.

Για να απαντησει ο μαθητης πρεπει να γνωριζει:

Από το πρώτο κεφάλαιο τον προσανατολισμό των πολυνουκλεοτιδικών αλυσίδων καθώς και την αντιπαραλληλία των δύο κλώνων ενός δίκλωνου μορίου νουκλεϊκών οξέων.

Από το δεύτερο κεφάλαιο τις διαδικασίες της μεταγραφής, της μετάφρασης  καθώς και τις ιδιότητες του γενετικού κώδικα.

Από το έκτο κεφάλαιο τον ορισμό της μετάλλαξης, την διάκριση των μεταλλάξεων αναλόγως του μεγέθους της αλλαγής, ειδικότερα τις γονιδιακές μεταλλάξεις και τις πιθανές αλλαγές που προκαλούν,  τόσο στο μόριο του  DNA όσο και κατά συνεπεία στα προϊόντα της μεταγραφής και πιθανόν της μετάφρασης.

Σύμφωνα λοιπόν με το παραπάνω περιεχόμενο του σχολικού βιβλίου και με βάση τα δεδομένα της εκφώνησης του ερωτήματος, ο μαθητής μπορεί να υποθέσει δυο πιθανούς τρόπους ένθεσης της τριπλέτας (με ποιο μηχανισμό έγινε δυνατή η ένθεση; αυτό δεν αναφέρεται σε κανένα σημείο του σχολικού βιβλίου βιολογίας) που δίνεται, δηλαδή είτε όπως δίνεται είτε ανεστραμμένη  (κατά 180 μοίρες).

Ως προς το αποτέλεσμα της μεταλλαγής, πρέπει να αναφερθεί ο μαθητής τόσο στην αλλαγή στο DNA, όσο και στα παραγόμενα προϊόντα κάθε φορά (μετάλλαξη), εφόσον δεν προσδιορίζεται από την εκφώνηση η έννοια του αποτελέσματος , αν αφορά μόνο το γενετικό υλικό ή και το προϊόν του μεταλλαγμένου γονιδίου. Φυσικά, αναλόγως του τρόπου ένθεσης της τριπλέτας θα έχουμε διαφορετικά αποτελέσματα.

Συνεπώς, η διατύπωση του ερωτήματος άφηνε πολλές εκδοχές, όπου ένας καλά προετοιμασμένος μαθητής που θα τις σκεφτόταν, και θα ήθελε να τις γράψει δεν είναι βέβαιο ότι θα πραλάβαινε στον δεδομένο χρόνο. Αν αυτός  μαθητής ιεραρχούσε την σειρά των απαντήσεων του σε αυτό το ερώτημα, με τέτοιο τρόπο, που δεν προλαβαινε να γράψει την απάντηση που δόθηκε από τον θεματοδότη και τον λύτη?

Καταλήγοντας λοιπόν σε αυτόν τον σχολιασμό των θεμάτων της Βιολογίας Ομάδας Θετικού Προσανατολισμού 2016, μπορούμε να πούμε ότι τα φετινά θέματα θα επιτρέψουν πιθανόν, αλλά και δικαίως, στο μάθημα της Βιολογίας, όπως αρμόζει άλλωστε, να καθορίζει την διάκριση των υποψηφίων στην εισαγωγή τους στις σχόλες του πεδίου των Επιστήμων Ζωής, αφού αυτό είναι έτσι και αλλιώς το αντικείμενο μελέτης αυτών των σχολών όπως η Ιατρική, το Βιολογικό κ.ά.

[ Αποτελεί Παγκόσμια πρωτοτυπία να εισάγονται μαθητές στα βιολογικά τμήματα χωρίς να έχουν διδαχθεί Βιολογία και να μην εισάγονται μαθητές στα χημικά τμήματα ενώ έχουν διδαχθεί την ίδια ακριβώς ύλη χημείας με αυτούς που έχουν την δυνατότητα να εισαχθούν!]

Όμως η προχειρότητα και οι αστοχίες στην διατύπωση των θεμάτων, περιορίζουν την αντικειμενική βαθμολόγηση, μειώνοντας σημαντικά την διακριτική ικανότητα των θεμάτων να ξεχωρίσουν τους άριστους από τους κάλους και τους κάλους από τους μέτριους με τρόπο αντικειμενικό, ειδικότερα όταν οι ενδεικτικές απαντήσεις της ΚΕΕ είναι οι μόνες σωστές και η φράση “ κάθε απάντηση επιστημονικά τεκμηριωμένη θεωρείται σωστή” έχει περιορισμένη χρήση και άξια.

Τα θέματα, ενώ πρέπει να βγαίνουν μέσα από την εξεταστέα ύλη του [ή μήπως των σχολικών βιβλίων  και των προηγούμενων τάξεων, όπως στην Φυσικη και την έκθεση φέτος, αλλά και στην Χημεία γενικότερα (δεν ορίζεται στην γ’ λυκείου η έννοια του mol, αλλά στην α’ λυκείου) ; ] σχολικού βιβλίου και να είναι ορθώς διατυπωμένα με σαφήνεια και ακρίβεια δηλαδή να είναι ορθά επιστημονικώς όσο και φιλολογικά, θα πρέπει να απαιτούν κριτική σκέψη με αναλυτική και συνθετική ικανότητα από τους μαθητές, ακόμη πρέπει να έχουν διαβαθμισμένη δυσκολία, αλλά και οι απαντήσεις των μαθητών να κρίνονται μέσα στα πλαίσια που επιτρέπει το σχολικό βιβλίο σε συνδυασμό με την  γνώση που έχει αποκτήσει ο μαθητής από τις προηγούμενες τάξεις, άλλα και φυσικά κάθε επιστημονικά τεκμηριωμένη απάντηση που ξεφεύγει από το σχολικό βιβλίο να λαμβάνεται ως ορθή, εφόσον είναι πράγματι ορθή.

‘Ομως και οι διορθωτές για να κρίνουν την ορθότητα μια απάντησης ενός μαθητή που ξεφεύγει από τις ενδεικτικές απαντήσεις της ΚΕΕ και την αυτούσια αναπαραγωγή των λεγομένων του σχολικού βιβλίου,  πρέπει να γνωρίζουν Βιολογία (όχι αυστηρά μόνο του λυκείου) καλύτερα από τον διαγωνιζόμενο!

‘Ενας διάγωνιζόμενος, είναι αρκετά πιθανό να είναι πρωτοετής φοιτητής του Βιολογικου τμήματος ή της Φαρμακευτικης ή της Γεωπονικης ή της Κτηνιατρικης κ.ά.  και ενώ  παρακολούθησε τη σχολή και έδωσε μαθήματα στην εξεταστική του χειμερινού α’ εξαμήνου ίσως και ορισμένα του εαρινού εξαμήνου (άρα διδάχθηκε και διάβασε Βιολογία από πανεπιστημιακούς δασκάλους και πανεπιστημιακά συγγράματα), αποφάσισε να ξαναδώσει  πανελλήνιες, πιθανόν για να περάσει στην  Ιατρική ή σε άλλη πόλη. Αυτός ο διαγωνιζόμενος λοιπόν, κινδυνεύει να μην επιτύχει το στόχο του ούτε την δεύτερη φορά, επειδή παρακολούθησε Βιολογία στο πανεπιστήμιο;

Και τα μέλη της ΚΕΕ, πρέπει να αναλαμβάνουν την ευθύνη των θεμάτων και των λύσεων τους με γνωστοποίηση των ονομάτων τους μετά το πέρας των εξετάσεων.

Οι πανελλήνιες είναι εν πολλοίς, αδιάβλητες είναι όμως και αδιαφανείς.

Εν όψη των αλλαγών που αυτόν τον καιρό, προτείνονται για την εισαγωγή στην τριτιβαθμια εκπαίδευση, τίποτα από τα παραπάνω δεν ακυρώνεται. Θα πρέπει να διαμορφωθεί ένα σύστημα αξιοκρατικό, δίκαιο, διαφάνες αυτή τη φορά, το οποίο θα συνεχίζει να είναι αδιάβλητο και θα μπορεί να Ελεγχεται σε κάθε του στάδιο.